Mutagenetix > Incidental Mutation

Incidental Mutation 'R1324:Rnf141'

157159

Institutional Source

Beutler Lab

Gene Symbol

Rnf141

Ensembl Gene

ENSMUSG00000030788

Gene Name

ring finger protein 141

Synonyms

ZFP36, ZNF230, 2610110L04Rik

MMRRC Submission

039390-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R1324 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110399639-110443664 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 110416050 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 184 (R184*)

Ref Sequence

ENSEMBL: ENSMUSP00000134781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005829] [ENSMUST00000106682] [ENSMUST00000170374] [ENSMUST00000175981] [ENSMUST00000177236] [ENSMUST00000213373] [ENSMUST00000177462]

AlphaFold

Q99MB7

Predicted Effect

probably benign
Transcript: ENSMUST00000005829

SMART Domains

Protein: ENSMUSP00000005829
Gene: ENSMUSG00000005686

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
Pfam:A_deaminase	309	716	1.5e-139	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000106682
AA Change: R184*

SMART Domains

Protein: ENSMUSP00000102293
Gene: ENSMUSG00000030788
AA Change: R184*

Domain	Start	End	E-Value	Type
RING	155	191	3.39e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170374

SMART Domains

Protein: ENSMUSP00000130495
Gene: ENSMUSG00000005686

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
Pfam:A_deaminase	309	716	7.6e-129	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000175648
AA Change: R12*

Predicted Effect

probably null
Transcript: ENSMUST00000175981
AA Change: R87*

SMART Domains

Protein: ENSMUSP00000135123
Gene: ENSMUSG00000030788
AA Change: R87*

Domain	Start	End	E-Value	Type
RING	58	94	3.39e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176048

Predicted Effect

probably benign
Transcript: ENSMUST00000176210

Predicted Effect

probably null
Transcript: ENSMUST00000177236
AA Change: R184*

SMART Domains

Protein: ENSMUSP00000134781
Gene: ENSMUSG00000030788
AA Change: R184*

Domain	Start	End	E-Value	Type
RING	155	191	3.39e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213373

Predicted Effect

probably benign
Transcript: ENSMUST00000177462

SMART Domains

Protein: ENSMUSP00000134917
Gene: ENSMUSG00000030788

Domain	Start	End	E-Value	Type
PDB:2ECN\|A	144	180	3e-21	PDB
SCOP:d1fbva4	146	180	3e-7	SMART
Blast:RING	155	180	6e-12	BLAST

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.4%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. Abundant expression of this gene was found in the testicular tissue of fertile men, but was not detected in azoospermic patients. Studies of the mouse counterpart suggest that this gene may function as a testis specific transcription factor during spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit decreased litter size but normal spermatogeness and testes weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap10	T	A	11: 61,805,847 (GRCm39)		probably null	Het
Col11a1	A	G	3: 113,824,565 (GRCm39)	R6G	unknown	Het
Enam	A	T	5: 88,641,927 (GRCm39)	Y172F	possibly damaging	Het
Fbxw15	G	A	9: 109,387,314 (GRCm39)	S227F	probably damaging	Het
Gjb3	G	A	4: 127,220,224 (GRCm39)	R103W	probably damaging	Het
Kif21a	A	T	15: 90,832,525 (GRCm39)		probably null	Het
Lmnb2	T	C	10: 80,740,005 (GRCm39)	I330V	possibly damaging	Het
Myom1	T	A	17: 71,359,714 (GRCm39)	I462N	probably damaging	Het
Negr1	C	T	3: 156,774,860 (GRCm39)	A192V	probably damaging	Het
Nrbp1	T	A	5: 31,403,157 (GRCm39)	I210N	probably damaging	Het
Nrxn3	T	C	12: 89,221,466 (GRCm39)	I42T	possibly damaging	Het
Pheta2	A	G	15: 82,227,699 (GRCm39)	T73A	probably damaging	Het
Serpinb6a	A	T	13: 34,102,343 (GRCm39)	L273H	probably damaging	Het
Thoc6	G	T	17: 23,896,437 (GRCm39)		probably null	Het
Tmem39a	T	A	16: 38,393,531 (GRCm39)	F77I	possibly damaging	Het
Ttn	T	C	2: 76,611,930 (GRCm39)	D15578G	probably damaging	Het
Usp25	T	A	16: 76,877,275 (GRCm39)	M587K	probably damaging	Het

Other mutations in Rnf141

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rnf141	APN	7	110,432,941 (GRCm39)	unclassified	probably benign
IGL02246:Rnf141	APN	7	110,424,494 (GRCm39)	missense	probably benign
IGL02336:Rnf141	APN	7	110,436,405 (GRCm39)	nonsense	probably null
R0482:Rnf141	UTSW	7	110,436,345 (GRCm39)	nonsense	probably null
R1718:Rnf141	UTSW	7	110,420,480 (GRCm39)	missense	probably damaging	1.00
R2067:Rnf141	UTSW	7	110,420,572 (GRCm39)	splice site	probably benign
R4151:Rnf141	UTSW	7	110,436,406 (GRCm39)	missense	probably benign	0.19
R4867:Rnf141	UTSW	7	110,415,975 (GRCm39)	missense	probably damaging	1.00
R4869:Rnf141	UTSW	7	110,424,557 (GRCm39)	missense	probably damaging	1.00
R4947:Rnf141	UTSW	7	110,424,527 (GRCm39)	missense	possibly damaging	0.66
R5320:Rnf141	UTSW	7	110,433,010 (GRCm39)	missense	probably damaging	1.00
R6364:Rnf141	UTSW	7	110,420,516 (GRCm39)	missense	possibly damaging	0.75
R8219:Rnf141	UTSW	7	110,436,472 (GRCm39)	start gained	probably benign
R8492:Rnf141	UTSW	7	110,436,407 (GRCm39)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TCCCTCCCTGAAAAGCAGTAGTGTC -3'
(R):5'- GCAACCAGTTGATCCTGGAAGAGAG -3'

Sequencing Primer
(F):5'- CTGCTATCTGTAGCAAAGGGC -3'
(R):5'- TCCTGGAAGAGAGAATTAAAGGTTG -3'

Posted On

2014-02-18