Incidental Mutation 'R1324:Fbxw15'
ID157161
Institutional Source Beutler Lab
Gene Symbol Fbxw15
Ensembl Gene ENSMUSG00000074060
Gene NameF-box and WD-40 domain protein 15
SynonymsFbxo12J
MMRRC Submission 039390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R1324 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109552602-109568262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109558246 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 227 (S227F)
Ref Sequence ENSEMBL: ENSMUSP00000058175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056745] [ENSMUST00000198112] [ENSMUST00000198397]
Predicted Effect probably damaging
Transcript: ENSMUST00000056745
AA Change: S227F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058175
Gene: ENSMUSG00000074060
AA Change: S227F

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1flga_ 73 413 3e-7 SMART
Blast:WD40 137 176 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000198112
AA Change: S174F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142894
Gene: ENSMUSG00000074060
AA Change: S174F

DomainStartEndE-ValueType
FBOX 8 45 2.1e-6 SMART
SCOP:d1tbga_ 73 196 3e-5 SMART
Blast:WD40 84 123 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198397
SMART Domains Protein: ENSMUSP00000143385
Gene: ENSMUSG00000074060

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1tbga_ 116 240 1e-3 SMART
Blast:WD40 137 176 6e-6 BLAST
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 T A 11: 61,915,021 probably null Het
Col11a1 A G 3: 114,030,916 R6G unknown Het
Enam A T 5: 88,494,068 Y172F possibly damaging Het
Fam109b A G 15: 82,343,498 T73A probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Kif21a A T 15: 90,948,322 probably null Het
Lmnb2 T C 10: 80,904,171 I330V possibly damaging Het
Myom1 T A 17: 71,052,719 I462N probably damaging Het
Negr1 C T 3: 157,069,223 A192V probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nrxn3 T C 12: 89,254,696 I42T possibly damaging Het
Rnf141 G A 7: 110,816,843 R184* probably null Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Thoc6 G T 17: 23,677,463 probably null Het
Tmem39a T A 16: 38,573,169 F77I possibly damaging Het
Ttn T C 2: 76,781,586 D15578G probably damaging Het
Usp25 T A 16: 77,080,387 M587K probably damaging Het
Other mutations in Fbxw15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02094:Fbxw15 APN 9 109558240 missense possibly damaging 0.87
IGL02239:Fbxw15 APN 9 109559837 missense probably benign 0.01
IGL02343:Fbxw15 APN 9 109552655 utr 3 prime probably benign
IGL02748:Fbxw15 APN 9 109558210 missense possibly damaging 0.66
IGL03206:Fbxw15 APN 9 109565362 missense possibly damaging 0.90
IGL03370:Fbxw15 APN 9 109555151 missense probably benign 0.00
lagging UTSW 9 109555673 unclassified probably null
R0321:Fbxw15 UTSW 9 109565385 missense probably benign 0.03
R0742:Fbxw15 UTSW 9 109555556 splice site probably null
R1141:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1143:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1276:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1282:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1283:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1321:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1341:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1716:Fbxw15 UTSW 9 109557136 missense probably benign 0.00
R1750:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1757:Fbxw15 UTSW 9 109557279 missense probably damaging 0.99
R1765:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1799:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1826:Fbxw15 UTSW 9 109559714 splice site probably null
R1897:Fbxw15 UTSW 9 109558203 nonsense probably null
R2237:Fbxw15 UTSW 9 109555235 missense probably damaging 0.99
R2346:Fbxw15 UTSW 9 109565432 missense probably damaging 1.00
R4391:Fbxw15 UTSW 9 109568232 start gained probably benign
R4392:Fbxw15 UTSW 9 109568232 start gained probably benign
R4812:Fbxw15 UTSW 9 109559922 missense probably benign 0.01
R5198:Fbxw15 UTSW 9 109558174 missense probably benign 0.00
R5278:Fbxw15 UTSW 9 109555684 missense probably benign 0.03
R5541:Fbxw15 UTSW 9 109565430 missense probably benign 0.23
R5899:Fbxw15 UTSW 9 109555673 unclassified probably null
R5975:Fbxw15 UTSW 9 109555252 missense probably damaging 1.00
R6065:Fbxw15 UTSW 9 109568178 missense probably damaging 1.00
R6285:Fbxw15 UTSW 9 109557166 missense probably benign 0.09
X0026:Fbxw15 UTSW 9 109558187 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCACATTTCAAGGACGCTTCAC -3'
(R):5'- GTTACCAACTGAGTCATCACCCCAG -3'

Sequencing Primer
(F):5'- GTCAGGTGACTGCTACCAAG -3'
(R):5'- ACTCTGTGAAGCAGGCTG -3'
Posted On2014-02-18