Mutagenetix > Incidental Mutation

Incidental Mutation 'R1324:Serpinb6a'

157165

Institutional Source

Beutler Lab

Gene Symbol

Serpinb6a

Ensembl Gene

ENSMUSG00000060147

Gene Name

serine (or cysteine) peptidase inhibitor, clade B, member 6a

Synonyms

D330015H01Rik, ovalbumin, 4930482L21Rik, Spi3

MMRRC Submission

039390-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1324 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34101901-34186777 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34102343 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 273 (L273H)

Ref Sequence

ENSEMBL: ENSMUSP00000131115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017188] [ENSMUST00000043552] [ENSMUST00000076532] [ENSMUST00000167163] [ENSMUST00000167260] [ENSMUST00000168350] [ENSMUST00000171034] [ENSMUST00000171252]

AlphaFold

Q60854

Predicted Effect

probably damaging
Transcript: ENSMUST00000017188
AA Change: L294H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000017188
Gene: ENSMUSG00000060147
AA Change: L294H

Domain	Start	End	E-Value	Type
SERPIN	34	399	2.84e-179	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000043552
AA Change: L273H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041016
Gene: ENSMUSG00000060147
AA Change: L273H

Domain	Start	End	E-Value	Type
SERPIN	13	378	2.84e-179	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000076532
AA Change: L273H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147
AA Change: L273H

Domain	Start	End	E-Value	Type
SERPIN	13	378	2.84e-179	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167163
AA Change: L273H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131115
Gene: ENSMUSG00000060147
AA Change: L273H

Domain	Start	End	E-Value	Type
SERPIN	13	378	2.84e-179	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167260

SMART Domains

Protein: ENSMUSP00000127768
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	193	1.34e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168350

SMART Domains

Protein: ENSMUSP00000130356
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	162	9.24e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171034

SMART Domains

Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	228	3.54e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171951

Predicted Effect

probably benign
Transcript: ENSMUST00000171252

SMART Domains

Protein: ENSMUSP00000126162
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	188	4.71e-9	SMART

Meta Mutation Damage Score

0.9567

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.4%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and developmentally normal, with no apparent alterations in growth, leukocyte function, or sensitivity to cerebral ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap10	T	A	11: 61,805,847 (GRCm39)		probably null	Het
Col11a1	A	G	3: 113,824,565 (GRCm39)	R6G	unknown	Het
Enam	A	T	5: 88,641,927 (GRCm39)	Y172F	possibly damaging	Het
Fbxw15	G	A	9: 109,387,314 (GRCm39)	S227F	probably damaging	Het
Gjb3	G	A	4: 127,220,224 (GRCm39)	R103W	probably damaging	Het
Kif21a	A	T	15: 90,832,525 (GRCm39)		probably null	Het
Lmnb2	T	C	10: 80,740,005 (GRCm39)	I330V	possibly damaging	Het
Myom1	T	A	17: 71,359,714 (GRCm39)	I462N	probably damaging	Het
Negr1	C	T	3: 156,774,860 (GRCm39)	A192V	probably damaging	Het
Nrbp1	T	A	5: 31,403,157 (GRCm39)	I210N	probably damaging	Het
Nrxn3	T	C	12: 89,221,466 (GRCm39)	I42T	possibly damaging	Het
Pheta2	A	G	15: 82,227,699 (GRCm39)	T73A	probably damaging	Het
Rnf141	G	A	7: 110,416,050 (GRCm39)	R184*	probably null	Het
Thoc6	G	T	17: 23,896,437 (GRCm39)		probably null	Het
Tmem39a	T	A	16: 38,393,531 (GRCm39)	F77I	possibly damaging	Het
Ttn	T	C	2: 76,611,930 (GRCm39)	D15578G	probably damaging	Het
Usp25	T	A	16: 76,877,275 (GRCm39)	M587K	probably damaging	Het

Other mutations in Serpinb6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Serpinb6a	APN	13	34,115,495 (GRCm39)	missense	possibly damaging	0.54
IGL01356:Serpinb6a	APN	13	34,109,400 (GRCm39)	missense	possibly damaging	0.76
IGL01458:Serpinb6a	APN	13	34,114,064 (GRCm39)	missense	possibly damaging	0.56
IGL01539:Serpinb6a	APN	13	34,114,117 (GRCm39)	missense	probably damaging	1.00
IGL02795:Serpinb6a	APN	13	34,115,576 (GRCm39)	missense	probably damaging	1.00
IGL02885:Serpinb6a	APN	13	34,102,782 (GRCm39)	missense	probably benign	0.11
IGL02971:Serpinb6a	APN	13	34,115,453 (GRCm39)	critical splice donor site	probably null
R0829:Serpinb6a	UTSW	13	34,119,684 (GRCm39)	utr 5 prime	probably benign
R2232:Serpinb6a	UTSW	13	34,109,303 (GRCm39)	missense	probably damaging	0.97
R3498:Serpinb6a	UTSW	13	34,102,764 (GRCm39)	missense	probably damaging	0.99
R4982:Serpinb6a	UTSW	13	34,102,857 (GRCm39)	missense	probably damaging	0.99
R5131:Serpinb6a	UTSW	13	34,102,855 (GRCm39)	missense	probably benign	0.42
R5132:Serpinb6a	UTSW	13	34,102,305 (GRCm39)	missense	probably benign	0.00
R6149:Serpinb6a	UTSW	13	34,102,343 (GRCm39)	missense	probably damaging	1.00
R6427:Serpinb6a	UTSW	13	34,102,242 (GRCm39)	missense	probably damaging	0.99
R6937:Serpinb6a	UTSW	13	34,102,801 (GRCm39)	missense	possibly damaging	0.81
R7806:Serpinb6a	UTSW	13	34,119,548 (GRCm39)	splice site	probably null
R7830:Serpinb6a	UTSW	13	34,114,030 (GRCm39)	missense	probably benign	0.09
R7948:Serpinb6a	UTSW	13	34,107,003 (GRCm39)	missense	probably benign	0.00
R7949:Serpinb6a	UTSW	13	34,107,003 (GRCm39)	missense	probably benign	0.00
R8531:Serpinb6a	UTSW	13	34,115,462 (GRCm39)	missense	probably damaging	0.99
R8773:Serpinb6a	UTSW	13	34,115,543 (GRCm39)	missense	probably damaging	1.00
R9117:Serpinb6a	UTSW	13	34,109,412 (GRCm39)	missense	probably benign	0.35
R9182:Serpinb6a	UTSW	13	34,109,360 (GRCm39)	missense	probably damaging	1.00
R9565:Serpinb6a	UTSW	13	34,102,400 (GRCm39)	missense	probably damaging	1.00
R9781:Serpinb6a	UTSW	13	34,109,346 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTGAATCTCATGCACCTCACCGTC -3'
(R):5'- TAGGTTACAGCCACACTTCCCTGG -3'

Sequencing Primer
(F):5'- TCACCGTCATCATGCCAG -3'
(R):5'- CTTCCCTGGGCACTGTAGAATG -3'

Posted On

2014-02-18