Incidental Mutation 'R1325:Dcxr'
ID 157190
Institutional Source Beutler Lab
Gene Symbol Dcxr
Ensembl Gene ENSMUSG00000039450
Gene Name dicarbonyl L-xylulose reductase
Synonyms 1810027P18Rik, 0610038K04Rik
MMRRC Submission 039391-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1325 (G1)
Quality Score 206
Status Not validated
Chromosome 11
Chromosomal Location 120616225-120618107 bp(-) (GRCm39)
Type of Mutation splice site (3224 bp from exon)
DNA Base Change (assembly) A to G at 120617381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000018156] [ENSMUST00000026144] [ENSMUST00000026148] [ENSMUST00000106148] [ENSMUST00000142229]
AlphaFold Q91X52
Predicted Effect probably benign
Transcript: ENSMUST00000018156
SMART Domains Protein: ENSMUSP00000018156
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 179 8.8e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026144
AA Change: V54A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000026144
Gene: ENSMUSG00000039450
AA Change: V54A

DomainStartEndE-ValueType
Pfam:adh_short 8 195 8.9e-51 PFAM
Pfam:KR 9 175 7.1e-9 PFAM
Pfam:Epimerase 10 227 2.3e-7 PFAM
Pfam:adh_short_C2 14 242 6.3e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000026148
SMART Domains Protein: ENSMUSP00000026148
Gene: ENSMUSG00000025150

DomainStartEndE-ValueType
Pfam:KR 9 178 8.5e-8 PFAM
Pfam:adh_short 9 195 4.6e-55 PFAM
Pfam:adh_short_C2 14 242 9.4e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106148
AA Change: V54A

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101754
Gene: ENSMUSG00000039450
AA Change: V54A

DomainStartEndE-ValueType
Pfam:adh_short 8 151 2.1e-22 PFAM
Pfam:KR 9 151 4.7e-7 PFAM
Pfam:NAD_binding_10 11 182 3.9e-9 PFAM
Pfam:adh_short_C2 14 150 2.2e-8 PFAM
Pfam:adh_short_C2 157 234 4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134322
Predicted Effect probably benign
Transcript: ENSMUST00000142229
SMART Domains Protein: ENSMUSP00000119523
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 172 3.19e-127 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154565
SMART Domains Protein: ENSMUSP00000117739
Gene: ENSMUSG00000025150

DomainStartEndE-ValueType
Pfam:adh_short 1 45 6.2e-10 PFAM
Pfam:adh_short_C2 33 154 9.7e-18 PFAM
Pfam:adh_short 41 123 2.2e-23 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to catalyze diacetyl reductase and L-xylulose reductase reactions. The encoded protein may play a role in the uronate cycle of glucose metabolism and in the cellular osmoregulation in the proximal renal tubules. Defects in this gene are a cause of pentosuria. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,499,938 (GRCm39) I293T possibly damaging Het
Abca14 A G 7: 119,846,545 (GRCm39) I666V probably benign Het
Acsl1 G A 8: 46,966,337 (GRCm39) V164I probably benign Het
Aox3 C T 1: 58,215,726 (GRCm39) Q1053* probably null Het
Arhgap31 A G 16: 38,423,304 (GRCm39) S921P probably benign Het
Bcl6 A G 16: 23,791,097 (GRCm39) M419T probably benign Het
Bdp1 A G 13: 100,235,516 (GRCm39) I145T probably damaging Het
Btaf1 T C 19: 36,946,562 (GRCm39) V456A possibly damaging Het
Cry2 T C 2: 92,244,115 (GRCm39) T353A probably damaging Het
Echdc1 A T 10: 29,193,544 (GRCm39) T14S probably benign Het
Fgd6 G A 10: 93,963,289 (GRCm39) R1129H probably damaging Het
Fstl1 A G 16: 37,649,083 (GRCm39) D197G probably damaging Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Krt1 A T 15: 101,756,641 (GRCm39) probably null Het
Lrrc9 C A 12: 72,543,878 (GRCm39) Q1116K probably damaging Het
Ncor2 T C 5: 125,195,844 (GRCm39) probably benign Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Or2j6 G A 7: 139,980,794 (GRCm39) P55L probably damaging Het
Prl2c2 G C 13: 13,176,786 (GRCm39) T47R probably damaging Het
Slc17a6 A G 7: 51,311,300 (GRCm39) E338G probably benign Het
Ttn A G 2: 76,730,738 (GRCm39) probably benign Het
Other mutations in Dcxr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Dcxr APN 11 120,616,993 (GRCm39) missense possibly damaging 0.75
IGL01516:Dcxr APN 11 120,616,584 (GRCm39) splice site probably null
IGL02151:Dcxr APN 11 120,616,809 (GRCm39) missense probably benign 0.00
IGL03264:Dcxr APN 11 120,617,298 (GRCm39) missense probably damaging 1.00
R0890:Dcxr UTSW 11 120,617,297 (GRCm39) missense probably damaging 1.00
R1808:Dcxr UTSW 11 120,616,438 (GRCm39) splice site probably null
R2099:Dcxr UTSW 11 120,616,403 (GRCm39) missense probably damaging 1.00
R2102:Dcxr UTSW 11 120,617,133 (GRCm39) missense probably benign 0.08
R4602:Dcxr UTSW 11 120,617,130 (GRCm39) missense possibly damaging 0.49
R4772:Dcxr UTSW 11 120,616,923 (GRCm39) missense probably benign 0.00
R5028:Dcxr UTSW 11 120,617,273 (GRCm39) missense probably damaging 0.97
R5219:Dcxr UTSW 11 120,616,314 (GRCm39) unclassified probably benign
R5336:Dcxr UTSW 11 120,618,002 (GRCm39) critical splice donor site probably null
R5518:Dcxr UTSW 11 120,617,025 (GRCm39) unclassified probably benign
R6613:Dcxr UTSW 11 120,617,832 (GRCm39) missense probably benign 0.00
R6833:Dcxr UTSW 11 120,616,917 (GRCm39) missense probably damaging 1.00
R7042:Dcxr UTSW 11 120,617,841 (GRCm39) missense possibly damaging 0.66
R7531:Dcxr UTSW 11 120,617,832 (GRCm39) missense probably benign 0.00
R7633:Dcxr UTSW 11 120,617,279 (GRCm39) missense probably benign 0.00
R7710:Dcxr UTSW 11 120,617,908 (GRCm39) missense probably benign 0.08
R9128:Dcxr UTSW 11 120,617,372 (GRCm39) missense
R9800:Dcxr UTSW 11 120,618,084 (GRCm39) unclassified probably benign
Z1176:Dcxr UTSW 11 120,618,034 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGGATGACAGCCCGAAGATTCAC -3'
(R):5'- TGCAGTTAGTCGAGGGTCCATGAG -3'

Sequencing Primer
(F):5'- GCCCGAAGATTCACATTGAAG -3'
(R):5'- GGACACAATTGCAGGACACA -3'
Posted On 2014-02-18