Incidental Mutation 'R1326:Armc3'
List |< first << previous [record 66 of 958] next >> last >|
ID157205
Institutional Source Beutler Lab
Gene Symbol Armc3
Ensembl Gene ENSMUSG00000037683
Gene Namearmadillo repeat containing 3
Synonyms4921513G22Rik
MMRRC Submission 039392-MU
Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1326 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location19199302-19310241 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 19310124 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 882 (*882Q)
Ref Sequence ENSEMBL: ENSMUSP00000110287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]
Predicted Effect probably null
Transcript: ENSMUST00000049255
AA Change: *870Q
SMART Domains Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: *870Q

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
low complexity region 544 557 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 675 696 N/A INTRINSIC
Pfam:EDR1 723 857 3.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114640
AA Change: *882Q
SMART Domains Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: *882Q

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
Pfam:EDR1 549 868 1.4e-41 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,683,930 P723H probably damaging Het
Arhgap5 G A 12: 52,518,370 S708N possibly damaging Het
Atp13a3 G A 16: 30,352,310 L306F probably damaging Het
Cyp2d9 T C 15: 82,455,156 I130T possibly damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Eomes C T 9: 118,484,497 Q518* probably null Het
Errfi1 T C 4: 150,865,164 V6A possibly damaging Het
Fezf2 T C 14: 12,342,644 N407S probably benign Het
Fpgs T C 2: 32,692,580 probably null Het
Fsbp A G 4: 11,579,891 Y53C probably damaging Het
Hspd1 T C 1: 55,080,259 probably null Het
Ifna7 A T 4: 88,816,694 E156V possibly damaging Het
Map1a C T 2: 121,306,190 Q2258* probably null Het
Mier2 A G 10: 79,544,709 F289S probably damaging Het
Mmp16 A G 4: 18,054,517 N341S possibly damaging Het
Moxd2 T C 6: 40,880,354 T491A probably benign Het
Narf T A 11: 121,242,553 L60Q probably damaging Het
Pa2g4 T C 10: 128,559,273 D341G probably benign Het
Parp1 T A 1: 180,600,458 V991D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc1a4 A G 11: 20,332,159 L105P probably damaging Het
Slc27a2 T A 2: 126,564,770 Y125N probably damaging Het
Sorl1 A G 9: 42,031,796 V928A probably benign Het
Usp31 G C 7: 121,648,302 S1306C probably damaging Het
Other mutations in Armc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Armc3 APN 2 19303858 missense possibly damaging 0.48
IGL01123:Armc3 APN 2 19201805 missense possibly damaging 0.87
IGL01142:Armc3 APN 2 19297898 splice site probably benign
IGL01556:Armc3 APN 2 19269146 missense probably damaging 1.00
IGL02145:Armc3 APN 2 19296860 missense possibly damaging 0.81
IGL02145:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02152:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02154:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02243:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02244:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02516:Armc3 APN 2 19300506 missense possibly damaging 0.94
IGL02691:Armc3 APN 2 19235484 missense probably damaging 1.00
IGL03151:Armc3 APN 2 19238698 missense probably damaging 1.00
IGL03190:Armc3 APN 2 19288950 missense probably damaging 0.99
IGL03288:Armc3 APN 2 19235482 missense probably damaging 1.00
IGL03338:Armc3 APN 2 19248701 missense possibly damaging 0.88
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0256:Armc3 UTSW 2 19269216 missense probably damaging 1.00
R0621:Armc3 UTSW 2 19295393 missense probably damaging 0.96
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1489:Armc3 UTSW 2 19310047 missense probably benign 0.01
R1990:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1991:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1992:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R2002:Armc3 UTSW 2 19288936 missense probably benign 0.01
R2095:Armc3 UTSW 2 19288929 missense possibly damaging 0.65
R2127:Armc3 UTSW 2 19201811 missense probably damaging 1.00
R2158:Armc3 UTSW 2 19248633 missense probably damaging 0.99
R2697:Armc3 UTSW 2 19303935 missense probably damaging 1.00
R3809:Armc3 UTSW 2 19300665 missense probably damaging 1.00
R3897:Armc3 UTSW 2 19269177 missense probably damaging 1.00
R4107:Armc3 UTSW 2 19288909 missense probably benign 0.13
R4326:Armc3 UTSW 2 19300473 missense probably damaging 0.97
R4464:Armc3 UTSW 2 19248659 missense probably damaging 0.99
R4702:Armc3 UTSW 2 19309981 missense probably damaging 1.00
R4923:Armc3 UTSW 2 19292980 critical splice acceptor site probably null
R5370:Armc3 UTSW 2 19286062 missense probably benign 0.00
R5518:Armc3 UTSW 2 19297928 missense probably benign 0.28
R5718:Armc3 UTSW 2 19303799 nonsense probably null
R5739:Armc3 UTSW 2 19253917 missense possibly damaging 0.67
R5913:Armc3 UTSW 2 19310047 missense possibly damaging 0.65
R6211:Armc3 UTSW 2 19296803 critical splice acceptor site probably null
R6245:Armc3 UTSW 2 19248705 missense probably damaging 1.00
R6841:Armc3 UTSW 2 19201819 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCTTGCAAATGACCCTGAGCC -3'
(R):5'- GGAGCATCGCATAGTCACATCCAC -3'

Sequencing Primer
(F):5'- CAGGCACTGGCTGATAAAATC -3'
(R):5'- CACATCCACAGTTTATTTCTACACAG -3'
Posted On2014-02-18