Mutagenetix > Incidental Mutation

Incidental Mutation 'R1326:Rin2'

157209

Institutional Source

Beutler Lab

Gene Symbol

Rin2

Ensembl Gene

ENSMUSG00000001768

Gene Name

Ras and Rab interactor 2

Synonyms

2010003K16Rik, RASSF4, 4632403N06Rik

MMRRC Submission

039392-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.321) question?

Stock #

R1326 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145613647-145729536 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 145702366 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 354 (T354I)

Ref Sequence

ENSEMBL: ENSMUSP00000105632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]

AlphaFold

Q9D684

Predicted Effect

probably benign
Transcript: ENSMUST00000094480
AA Change: T309I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: T309I

Domain	Start	End	E-Value	Type
SH2	50	136	1.38e-3	SMART
low complexity region	175	187	N/A	INTRINSIC
low complexity region	258	269	N/A	INTRINSIC
low complexity region	335	352	N/A	INTRINSIC
low complexity region	375	385	N/A	INTRINSIC
low complexity region	393	411	N/A	INTRINSIC
Blast:SH2	540	576	2e-7	BLAST
VPS9	612	730	1.72e-68	SMART
RA	751	842	3.35e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110005
AA Change: T354I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: T354I

Domain	Start	End	E-Value	Type
SH2	95	181	1.38e-3	SMART
low complexity region	220	232	N/A	INTRINSIC
low complexity region	303	314	N/A	INTRINSIC
low complexity region	380	397	N/A	INTRINSIC
low complexity region	420	430	N/A	INTRINSIC
low complexity region	438	456	N/A	INTRINSIC
Blast:SH2	585	621	2e-7	BLAST
VPS9	657	775	1.72e-68	SMART
RA	796	887	3.35e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145874

Predicted Effect

probably benign
Transcript: ENSMUST00000147976

Meta Mutation Damage Score

0.0630

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.7%
20x: 87.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap5	G	A	12: 52,565,153 (GRCm39)	S708N	possibly damaging	Het
Armc3	T	C	2: 19,314,935 (GRCm39)	*882Q	probably null	Het
Atp13a3	G	A	16: 30,171,128 (GRCm39)	L306F	probably damaging	Het
Cyp2d9	T	C	15: 82,339,357 (GRCm39)	I130T	possibly damaging	Het
Ect2l	C	T	10: 18,041,290 (GRCm39)	R296H	probably benign	Het
Eomes	C	T	9: 118,313,565 (GRCm39)	Q518*	probably null	Het
Errfi1	T	C	4: 150,949,621 (GRCm39)	V6A	possibly damaging	Het
Fezf2	T	C	14: 12,342,644 (GRCm38)	N407S	probably benign	Het
Fpgs	T	C	2: 32,582,592 (GRCm39)		probably null	Het
Fsbp	A	G	4: 11,579,891 (GRCm39)	Y53C	probably damaging	Het
Hspd1	T	C	1: 55,119,418 (GRCm39)		probably null	Het
Ifna7	A	T	4: 88,734,931 (GRCm39)	E156V	possibly damaging	Het
Map1a	C	T	2: 121,136,671 (GRCm39)	Q2258*	probably null	Het
Mier2	A	G	10: 79,380,543 (GRCm39)	F289S	probably damaging	Het
Mmp16	A	G	4: 18,054,517 (GRCm39)	N341S	possibly damaging	Het
Moxd2	T	C	6: 40,857,288 (GRCm39)	T491A	probably benign	Het
Narf	T	A	11: 121,133,379 (GRCm39)	L60Q	probably damaging	Het
Pa2g4	T	C	10: 128,395,142 (GRCm39)	D341G	probably benign	Het
Parp1	T	A	1: 180,428,023 (GRCm39)	V991D	probably damaging	Het
Slc1a4	A	G	11: 20,282,159 (GRCm39)	L105P	probably damaging	Het
Slc27a2	T	A	2: 126,406,690 (GRCm39)	Y125N	probably damaging	Het
Sorl1	A	G	9: 41,943,092 (GRCm39)	V928A	probably benign	Het
Spata31e2	G	T	1: 26,723,011 (GRCm39)	P723H	probably damaging	Het
Usp31	G	C	7: 121,247,525 (GRCm39)	S1306C	probably damaging	Het

Other mutations in Rin2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02928:Rin2	APN	2	145,701,926 (GRCm39)	splice site	probably benign
IGL03222:Rin2	APN	2	145,702,115 (GRCm39)	nonsense	probably null
IGL03371:Rin2	APN	2	145,727,846 (GRCm39)	utr 3 prime	probably benign
IGL03411:Rin2	APN	2	145,702,864 (GRCm39)	missense	probably damaging	0.99
D4043:Rin2	UTSW	2	145,664,283 (GRCm39)	missense	possibly damaging	0.61
R0025:Rin2	UTSW	2	145,720,752 (GRCm39)	splice site	probably benign
R0110:Rin2	UTSW	2	145,702,953 (GRCm39)	missense	probably benign
R0144:Rin2	UTSW	2	145,718,559 (GRCm39)	missense	probably damaging	0.96
R0510:Rin2	UTSW	2	145,702,953 (GRCm39)	missense	probably benign
R1327:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R1328:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R1329:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R1330:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R1544:Rin2	UTSW	2	145,700,366 (GRCm39)	missense	probably damaging	1.00
R1658:Rin2	UTSW	2	145,718,376 (GRCm39)	missense	probably benign	0.04
R1832:Rin2	UTSW	2	145,703,091 (GRCm39)	missense	possibly damaging	0.48
R1986:Rin2	UTSW	2	145,720,860 (GRCm39)	missense	probably damaging	1.00
R2137:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R2167:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R2170:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R2260:Rin2	UTSW	2	145,720,824 (GRCm39)	missense	probably damaging	0.97
R2312:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R2884:Rin2	UTSW	2	145,702,911 (GRCm39)	missense	probably benign	0.07
R3155:Rin2	UTSW	2	145,702,771 (GRCm39)	missense	probably benign	0.17
R3771:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R3772:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R3773:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R3822:Rin2	UTSW	2	145,664,550 (GRCm39)	missense	probably benign	0.02
R3824:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R3825:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R3885:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R3893:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R3939:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R3940:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4012:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4019:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4058:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4214:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4231:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4232:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4236:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4372:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4410:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4415:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4471:Rin2	UTSW	2	145,702,366 (GRCm39)	missense	probably benign	0.00
R4490:Rin2	UTSW	2	145,664,194 (GRCm39)	missense	possibly damaging	0.66
R4597:Rin2	UTSW	2	145,702,825 (GRCm39)	missense	probably benign	0.01
R5099:Rin2	UTSW	2	145,720,821 (GRCm39)	missense	probably damaging	1.00
R5268:Rin2	UTSW	2	145,686,680 (GRCm39)	missense	probably benign
R5493:Rin2	UTSW	2	145,702,629 (GRCm39)	missense	probably damaging	1.00
R5622:Rin2	UTSW	2	145,702,299 (GRCm39)	missense	probably benign	0.07
R5947:Rin2	UTSW	2	145,686,863 (GRCm39)	intron	probably benign
R6280:Rin2	UTSW	2	145,702,939 (GRCm39)	missense	probably damaging	1.00
R7009:Rin2	UTSW	2	145,725,395 (GRCm39)	missense	probably damaging	1.00
R7531:Rin2	UTSW	2	145,700,419 (GRCm39)	missense	probably benign
R7824:Rin2	UTSW	2	145,703,037 (GRCm39)	missense	probably benign	0.00
R8065:Rin2	UTSW	2	145,702,977 (GRCm39)	missense	probably damaging	0.99
R8067:Rin2	UTSW	2	145,702,977 (GRCm39)	missense	probably damaging	0.99
R8144:Rin2	UTSW	2	145,664,225 (GRCm39)	missense	probably benign
R8510:Rin2	UTSW	2	145,727,611 (GRCm39)	missense	probably damaging	1.00
R8853:Rin2	UTSW	2	145,718,475 (GRCm39)	missense	possibly damaging	0.68
R8880:Rin2	UTSW	2	145,690,772 (GRCm39)	missense	probably damaging	1.00
R9224:Rin2	UTSW	2	145,720,822 (GRCm39)	nonsense	probably null
R9325:Rin2	UTSW	2	145,727,819 (GRCm39)	missense	probably benign	0.15
R9417:Rin2	UTSW	2	145,686,713 (GRCm39)	missense	probably benign	0.02
R9555:Rin2	UTSW	2	145,718,415 (GRCm39)	nonsense	probably null
R9631:Rin2	UTSW	2	145,718,437 (GRCm39)	missense	probably damaging	1.00
R9667:Rin2	UTSW	2	145,702,202 (GRCm39)	missense	possibly damaging	0.89
R9691:Rin2	UTSW	2	145,690,764 (GRCm39)	missense	probably damaging	0.97
R9727:Rin2	UTSW	2	145,702,506 (GRCm39)	missense	possibly damaging	0.94
R9780:Rin2	UTSW	2	145,718,551 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGTCAGCTCTGCCTTATAAATGG -3'
(R):5'- AAGTGGAAAGGCTCATGTCGCTC -3'

Sequencing Primer
(F):5'- CTCTGCCTTATAAATGGAGTGC -3'
(R):5'- GGCTGTGATTCAGAGCCG -3'

Posted On

2014-02-18