Incidental Mutation 'R1326:Errfi1'
ID157214
Institutional Source Beutler Lab
Gene Symbol Errfi1
Ensembl Gene ENSMUSG00000028967
Gene NameERBB receptor feedback inhibitor 1
SynonymsMig-6, RALT, 1300002F13Rik
MMRRC Submission 039392-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R1326 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location150853919-150868892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150865164 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 6 (V6A)
Ref Sequence ENSEMBL: ENSMUSP00000073285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030811] [ENSMUST00000073600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030811
AA Change: V6A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030811
Gene: ENSMUSG00000028967
AA Change: V6A

DomainStartEndE-ValueType
Pfam:GTPase_binding 4 67 5.5e-40 PFAM
low complexity region 171 186 N/A INTRINSIC
low complexity region 227 241 N/A INTRINSIC
low complexity region 279 295 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 314 370 9.5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000073600
AA Change: V6A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073285
Gene: ENSMUSG00000028967
AA Change: V6A

DomainStartEndE-ValueType
Pfam:GTPase_binding 4 67 4.1e-36 PFAM
low complexity region 171 186 N/A INTRINSIC
low complexity region 227 241 N/A INTRINSIC
low complexity region 279 295 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 314 371 6.2e-28 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ERRFI1 is a cytoplasmic protein whose expression is upregulated with cell growth (Wick et al., 1995 [PubMed 7641805]). It shares significant homology with the protein product of rat gene-33, which is induced during cell stress and mediates cell signaling (Makkinje et al., 2000 [PubMed 10749885]; Fiorentino et al., 2000 [PubMed 11003669]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene may lead to premature death, delayed eyelid opening, epidermal hyperplasia, degenerative joint disease, skin or lung cancer, gastrointestinal tract tumors, increased susceptibility to chemically-induced tumors, and impaired lung development and vascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,683,930 P723H probably damaging Het
Arhgap5 G A 12: 52,518,370 S708N possibly damaging Het
Armc3 T C 2: 19,310,124 *882Q probably null Het
Atp13a3 G A 16: 30,352,310 L306F probably damaging Het
Cyp2d9 T C 15: 82,455,156 I130T possibly damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Eomes C T 9: 118,484,497 Q518* probably null Het
Fezf2 T C 14: 12,342,644 N407S probably benign Het
Fpgs T C 2: 32,692,580 probably null Het
Fsbp A G 4: 11,579,891 Y53C probably damaging Het
Hspd1 T C 1: 55,080,259 probably null Het
Ifna7 A T 4: 88,816,694 E156V possibly damaging Het
Map1a C T 2: 121,306,190 Q2258* probably null Het
Mier2 A G 10: 79,544,709 F289S probably damaging Het
Mmp16 A G 4: 18,054,517 N341S possibly damaging Het
Moxd2 T C 6: 40,880,354 T491A probably benign Het
Narf T A 11: 121,242,553 L60Q probably damaging Het
Pa2g4 T C 10: 128,559,273 D341G probably benign Het
Parp1 T A 1: 180,600,458 V991D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc1a4 A G 11: 20,332,159 L105P probably damaging Het
Slc27a2 T A 2: 126,564,770 Y125N probably damaging Het
Sorl1 A G 9: 42,031,796 V928A probably benign Het
Usp31 G C 7: 121,648,302 S1306C probably damaging Het
Other mutations in Errfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Errfi1 APN 4 150867030 missense probably damaging 0.99
IGL02425:Errfi1 APN 4 150866356 missense probably benign 0.01
R1530:Errfi1 UTSW 4 150865386 missense probably benign 0.36
R3162:Errfi1 UTSW 4 150867359 missense probably damaging 1.00
R3162:Errfi1 UTSW 4 150867359 missense probably damaging 1.00
R4720:Errfi1 UTSW 4 150866747 missense probably damaging 1.00
R6916:Errfi1 UTSW 4 150867473 nonsense probably null
R7099:Errfi1 UTSW 4 150866768 missense probably benign 0.01
R7447:Errfi1 UTSW 4 150866651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGAGCAACTGGTAAGCTCTGC -3'
(R):5'- GCTGCCACTAGGTGTCAGACTATTG -3'

Sequencing Primer
(F):5'- CTGTGAAAAACCTTTCAAGTGTCAAG -3'
(R):5'- GAAATACTGCTTGCTTGAGGAC -3'
Posted On2014-02-18