Incidental Mutation 'R1326:Moxd2'
ID157215
Institutional Source Beutler Lab
Gene Symbol Moxd2
Ensembl Gene ENSMUSG00000029885
Gene Namemonooxygenase, DBH-like 2
SynonymsDbhl1
MMRRC Submission 039392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1326 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location40878794-40887494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40880354 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 491 (T491A)
Ref Sequence ENSEMBL: ENSMUSP00000031937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031937]
Predicted Effect probably benign
Transcript: ENSMUST00000031937
AA Change: T491A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031937
Gene: ENSMUSG00000029885
AA Change: T491A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
DoH 66 156 1.43e-12 SMART
Pfam:Cu2_monooxygen 192 316 8.3e-39 PFAM
Pfam:Cu2_monoox_C 336 493 1.8e-37 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,683,930 P723H probably damaging Het
Arhgap5 G A 12: 52,518,370 S708N possibly damaging Het
Armc3 T C 2: 19,310,124 *882Q probably null Het
Atp13a3 G A 16: 30,352,310 L306F probably damaging Het
Cyp2d9 T C 15: 82,455,156 I130T possibly damaging Het
Ect2l C T 10: 18,165,542 R296H probably benign Het
Eomes C T 9: 118,484,497 Q518* probably null Het
Errfi1 T C 4: 150,865,164 V6A possibly damaging Het
Fezf2 T C 14: 12,342,644 N407S probably benign Het
Fpgs T C 2: 32,692,580 probably null Het
Fsbp A G 4: 11,579,891 Y53C probably damaging Het
Hspd1 T C 1: 55,080,259 probably null Het
Ifna7 A T 4: 88,816,694 E156V possibly damaging Het
Map1a C T 2: 121,306,190 Q2258* probably null Het
Mier2 A G 10: 79,544,709 F289S probably damaging Het
Mmp16 A G 4: 18,054,517 N341S possibly damaging Het
Narf T A 11: 121,242,553 L60Q probably damaging Het
Pa2g4 T C 10: 128,559,273 D341G probably benign Het
Parp1 T A 1: 180,600,458 V991D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Slc1a4 A G 11: 20,332,159 L105P probably damaging Het
Slc27a2 T A 2: 126,564,770 Y125N probably damaging Het
Sorl1 A G 9: 42,031,796 V928A probably benign Het
Usp31 G C 7: 121,648,302 S1306C probably damaging Het
Other mutations in Moxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Moxd2 APN 6 40884179 splice site probably benign
IGL02113:Moxd2 APN 6 40885404 missense probably benign 0.06
IGL02223:Moxd2 APN 6 40885033 missense probably damaging 1.00
IGL03204:Moxd2 APN 6 40887305 missense probably benign 0.04
IGL03385:Moxd2 APN 6 40879018 missense probably damaging 1.00
R0084:Moxd2 UTSW 6 40879408 missense probably null 0.01
R1213:Moxd2 UTSW 6 40891897 unclassified probably benign
R1652:Moxd2 UTSW 6 40887403 missense probably damaging 1.00
R1940:Moxd2 UTSW 6 40883532 missense probably damaging 1.00
R2040:Moxd2 UTSW 6 40884953 splice site probably null
R2088:Moxd2 UTSW 6 40884967 missense probably damaging 1.00
R3018:Moxd2 UTSW 6 40878886 missense probably benign 0.01
R3962:Moxd2 UTSW 6 40885397 missense probably benign
R4248:Moxd2 UTSW 6 40878999 missense probably damaging 1.00
R4438:Moxd2 UTSW 6 40884062 missense probably damaging 1.00
R4715:Moxd2 UTSW 6 40887247 missense probably damaging 1.00
R4732:Moxd2 UTSW 6 40878859 missense probably benign
R4733:Moxd2 UTSW 6 40878859 missense probably benign
R4760:Moxd2 UTSW 6 40891603 missense probably benign 0.06
R4851:Moxd2 UTSW 6 40878822 missense probably damaging 1.00
R5087:Moxd2 UTSW 6 40879336 missense probably damaging 1.00
R5187:Moxd2 UTSW 6 40879337 missense probably benign 0.18
R5339:Moxd2 UTSW 6 40885420 missense probably damaging 1.00
R5452:Moxd2 UTSW 6 40882114 splice site probably null
R5860:Moxd2 UTSW 6 40880407 missense probably damaging 1.00
R5973:Moxd2 UTSW 6 40878810 missense probably damaging 0.96
R6015:Moxd2 UTSW 6 40883754 missense probably damaging 1.00
R6316:Moxd2 UTSW 6 40883547 missense probably damaging 1.00
X0052:Moxd2 UTSW 6 40882528 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATAGGGTCTGAGAGCTGGTTGAAT -3'
(R):5'- TGACAACTTTCACAGTTTGTTGTTTGCC -3'

Sequencing Primer
(F):5'- agagacaaagaaacaaagaaacaaag -3'
(R):5'- CACAGTTTGTTGTTTGCCTTTTC -3'
Posted On2014-02-18