Incidental Mutation 'R1326:Narf'
ID 157225
Institutional Source Beutler Lab
Gene Symbol Narf
Ensembl Gene ENSMUSG00000000056
Gene Name nuclear prelamin A recognition factor
Synonyms 4430402O11Rik
MMRRC Submission 039392-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R1326 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 121128079-121146682 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121133379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 60 (L60Q)
Ref Sequence ENSEMBL: ENSMUSP00000099304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103015]
AlphaFold Q9CYQ7
Predicted Effect probably damaging
Transcript: ENSMUST00000103015
AA Change: L60Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099304
Gene: ENSMUSG00000000056
AA Change: L60Q

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 98 391 1e-75 PFAM
Fe_hyd_SSU 396 452 5.66e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154047
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Several proteins have been found to be prenylated and methylated at their carboxyl-terminal ends. Prenylation was initially believed to be important only for membrane attachment. However, another role for prenylation appears to be its importance in protein-protein interactions. The only nuclear proteins known to be prenylated in mammalian cells are prelamin A- and B-type lamins. Prelamin A is farnesylated and carboxymethylated on the cysteine residue of a carboxyl-terminal CaaX motif. This post-translationally modified cysteine residue is removed from prelamin A when it is endoproteolytically processed into mature lamin A. The protein encoded by this gene binds to the prenylated prelamin A carboxyl-terminal tail domain. It may be a component of a prelamin A endoprotease complex. The encoded protein is located in the nucleus, where it partially colocalizes with the nuclear lamina. It shares limited sequence similarity with iron-only bacterial hydrogenases. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene, including one with a novel exon that is generated by RNA editing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap5 G A 12: 52,565,153 (GRCm39) S708N possibly damaging Het
Armc3 T C 2: 19,314,935 (GRCm39) *882Q probably null Het
Atp13a3 G A 16: 30,171,128 (GRCm39) L306F probably damaging Het
Cyp2d9 T C 15: 82,339,357 (GRCm39) I130T possibly damaging Het
Ect2l C T 10: 18,041,290 (GRCm39) R296H probably benign Het
Eomes C T 9: 118,313,565 (GRCm39) Q518* probably null Het
Errfi1 T C 4: 150,949,621 (GRCm39) V6A possibly damaging Het
Fezf2 T C 14: 12,342,644 (GRCm38) N407S probably benign Het
Fpgs T C 2: 32,582,592 (GRCm39) probably null Het
Fsbp A G 4: 11,579,891 (GRCm39) Y53C probably damaging Het
Hspd1 T C 1: 55,119,418 (GRCm39) probably null Het
Ifna7 A T 4: 88,734,931 (GRCm39) E156V possibly damaging Het
Map1a C T 2: 121,136,671 (GRCm39) Q2258* probably null Het
Mier2 A G 10: 79,380,543 (GRCm39) F289S probably damaging Het
Mmp16 A G 4: 18,054,517 (GRCm39) N341S possibly damaging Het
Moxd2 T C 6: 40,857,288 (GRCm39) T491A probably benign Het
Pa2g4 T C 10: 128,395,142 (GRCm39) D341G probably benign Het
Parp1 T A 1: 180,428,023 (GRCm39) V991D probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Slc1a4 A G 11: 20,282,159 (GRCm39) L105P probably damaging Het
Slc27a2 T A 2: 126,406,690 (GRCm39) Y125N probably damaging Het
Sorl1 A G 9: 41,943,092 (GRCm39) V928A probably benign Het
Spata31e2 G T 1: 26,723,011 (GRCm39) P723H probably damaging Het
Usp31 G C 7: 121,247,525 (GRCm39) S1306C probably damaging Het
Other mutations in Narf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Narf APN 11 121,129,344 (GRCm39) critical splice donor site probably null
R0128:Narf UTSW 11 121,141,662 (GRCm39) missense probably damaging 1.00
R0542:Narf UTSW 11 121,143,690 (GRCm39) missense probably damaging 1.00
R2035:Narf UTSW 11 121,129,326 (GRCm39) missense probably benign 0.00
R2049:Narf UTSW 11 121,141,195 (GRCm39) nonsense probably null
R2078:Narf UTSW 11 121,136,220 (GRCm39) missense probably benign 0.03
R3711:Narf UTSW 11 121,137,764 (GRCm39) nonsense probably null
R3967:Narf UTSW 11 121,129,247 (GRCm39) missense possibly damaging 0.92
R3968:Narf UTSW 11 121,129,247 (GRCm39) missense possibly damaging 0.92
R3970:Narf UTSW 11 121,129,247 (GRCm39) missense possibly damaging 0.92
R4128:Narf UTSW 11 121,141,261 (GRCm39) splice site probably null
R4913:Narf UTSW 11 121,135,469 (GRCm39) missense probably damaging 1.00
R4928:Narf UTSW 11 121,135,765 (GRCm39) missense possibly damaging 0.87
R4946:Narf UTSW 11 121,141,179 (GRCm39) missense possibly damaging 0.71
R5404:Narf UTSW 11 121,133,452 (GRCm39) missense probably benign 0.00
R5799:Narf UTSW 11 121,135,480 (GRCm39) missense probably damaging 1.00
R6753:Narf UTSW 11 121,133,452 (GRCm39) missense probably benign 0.00
R6912:Narf UTSW 11 121,129,287 (GRCm39) missense probably benign 0.00
R7311:Narf UTSW 11 121,139,976 (GRCm39) missense probably benign 0.31
R8056:Narf UTSW 11 121,136,170 (GRCm39) missense possibly damaging 0.89
R8559:Narf UTSW 11 121,141,258 (GRCm39) critical splice donor site probably null
R9021:Narf UTSW 11 121,136,209 (GRCm39) missense probably damaging 0.98
X0011:Narf UTSW 11 121,141,698 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAAAGAAGCAATGCTACCagcc -3'
(R):5'- TCACAAAACATCAGTAAACCCTATCACATCAA -3'

Sequencing Primer
(F):5'- agtacctttaatcccagcactc -3'
(R):5'- ccacccacccacccatc -3'
Posted On 2014-02-18