Mutagenetix > Incidental Mutation

Incidental Mutation 'R1328:Il23r'

157276

Institutional Source

Beutler Lab

Gene Symbol

Il23r

Ensembl Gene

ENSMUSG00000049093

Gene Name

interleukin 23 receptor

Synonyms

MMRRC Submission

039394-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1328 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

67399916-67468839 bp(-) (GRCm39)

Type of Mutation

start gained

DNA Base Change (assembly)

T to A at 67468802 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113342 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118364]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000118364

SMART Domains

Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093

Domain	Start	End	E-Value	Type
FN3	140	220	1e-1	SMART
Blast:FN3	235	317	2e-38	BLAST
transmembrane domain	388	410	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.2%
20x: 89.9%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp4	C	T	7: 43,906,516 (GRCm39)		probably null	Het
Bcap29	T	C	12: 31,680,807 (GRCm39)	I60V	probably benign	Het
Ccdc71	T	A	9: 108,340,148 (GRCm39)		probably benign	Het
Ccnb1ip1	A	T	14: 51,027,382 (GRCm39)	V240E	probably benign	Het
Copa	C	T	1: 171,949,258 (GRCm39)		probably benign	Het
Dmxl2	G	T	9: 54,303,533 (GRCm39)	Q2314K	probably benign	Het
Fam181b	T	C	7: 92,729,437 (GRCm39)	I70T	probably damaging	Het
Fbxl14	T	C	6: 119,457,347 (GRCm39)	L176P	possibly damaging	Het
Fip1l1	T	A	5: 74,706,796 (GRCm39)	F144L	possibly damaging	Het
Flnc	T	C	6: 29,438,612 (GRCm39)	W169R	probably damaging	Het
H2-M3	T	C	17: 37,581,925 (GRCm39)	V127A	possibly damaging	Het
Krt18	C	T	15: 101,939,169 (GRCm39)	A251V	probably benign	Het
Mast1	A	G	8: 85,644,617 (GRCm39)		probably benign	Het
Or6c202	A	G	10: 128,996,293 (GRCm39)	S187P	possibly damaging	Het
Or9i14	G	A	19: 13,792,900 (GRCm39)	T18I	probably benign	Het
Pkhd1l1	T	C	15: 44,361,392 (GRCm39)	Y481H	probably benign	Het
Polr3e	C	T	7: 120,533,046 (GRCm39)		probably benign	Het
Pou4f2	G	A	8: 79,162,759 (GRCm39)	A92V	probably benign	Het
Pramel5	A	G	4: 143,998,058 (GRCm39)	L395P	probably damaging	Het
Prmt9	T	C	8: 78,299,283 (GRCm39)	I659T	possibly damaging	Het
Rin2	C	T	2: 145,702,366 (GRCm39)	T354I	probably benign	Het
Rrp36	T	A	17: 46,983,705 (GRCm39)	K36*	probably null	Het
Sag	G	A	1: 87,738,016 (GRCm39)		probably benign	Het
Setd7	T	C	3: 51,450,240 (GRCm39)	Y62C	possibly damaging	Het
Smr2	AT	ATT	5: 88,256,683 (GRCm39)		probably null	Het
Sox13	T	C	1: 133,311,555 (GRCm39)	D559G	probably damaging	Het
Srd5a1	T	A	13: 69,723,310 (GRCm39)	Y236F	probably damaging	Het
Stxbp2	A	T	8: 3,692,657 (GRCm39)	I570F	possibly damaging	Het
Tbc1d31	T	C	15: 57,805,859 (GRCm39)		probably benign	Het
Trim33	A	G	3: 103,260,913 (GRCm39)	T1064A	possibly damaging	Het
Vmn1r8	T	C	6: 57,013,278 (GRCm39)	S110P	possibly damaging	Het
Vmn2r118	C	A	17: 55,915,620 (GRCm39)	M443I	probably benign	Het

Other mutations in Il23r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00668:Il23r	APN	6	67,400,612 (GRCm39)	missense	probably damaging	0.96
IGL00886:Il23r	APN	6	67,450,874 (GRCm39)	missense	possibly damaging	0.94
IGL00916:Il23r	APN	6	67,450,915 (GRCm39)	missense	probably damaging	1.00
IGL01102:Il23r	APN	6	67,400,909 (GRCm39)	missense	probably damaging	0.98
IGL01466:Il23r	APN	6	67,403,626 (GRCm39)	missense	probably benign	0.30
IGL01627:Il23r	APN	6	67,400,412 (GRCm39)	missense	probably benign	0.17
IGL02160:Il23r	APN	6	67,400,562 (GRCm39)	missense	probably benign	0.09
IGL02394:Il23r	APN	6	67,443,256 (GRCm39)	splice site	probably benign
IGL02418:Il23r	APN	6	67,467,656 (GRCm39)	missense	possibly damaging	0.46
IGL02818:Il23r	APN	6	67,463,078 (GRCm39)	critical splice donor site	probably null
IGL03230:Il23r	APN	6	67,400,948 (GRCm39)	missense	probably benign	0.31
R0029:Il23r	UTSW	6	67,455,929 (GRCm39)	critical splice donor site	probably null
R0029:Il23r	UTSW	6	67,455,929 (GRCm39)	critical splice donor site	probably null
R0035:Il23r	UTSW	6	67,450,772 (GRCm39)	splice site	probably benign
R0035:Il23r	UTSW	6	67,450,772 (GRCm39)	splice site	probably benign
R0085:Il23r	UTSW	6	67,463,206 (GRCm39)	missense	probably damaging	1.00
R0477:Il23r	UTSW	6	67,429,361 (GRCm39)	missense	probably benign	0.00
R0534:Il23r	UTSW	6	67,403,572 (GRCm39)	missense	probably benign	0.00
R0547:Il23r	UTSW	6	67,463,235 (GRCm39)	missense	possibly damaging	0.57
R0547:Il23r	UTSW	6	67,400,685 (GRCm39)	missense	probably benign	0.05
R0666:Il23r	UTSW	6	67,411,664 (GRCm39)	missense	probably benign	0.08
R0702:Il23r	UTSW	6	67,443,269 (GRCm39)	missense	probably damaging	0.97
R0715:Il23r	UTSW	6	67,463,317 (GRCm39)	missense	possibly damaging	0.63
R1077:Il23r	UTSW	6	67,450,794 (GRCm39)	missense	probably benign	0.40
R1202:Il23r	UTSW	6	67,455,937 (GRCm39)	missense	possibly damaging	0.95
R1378:Il23r	UTSW	6	67,429,394 (GRCm39)	missense	possibly damaging	0.68
R1420:Il23r	UTSW	6	67,463,181 (GRCm39)	missense	probably damaging	1.00
R1475:Il23r	UTSW	6	67,429,280 (GRCm39)	critical splice donor site	probably null
R1628:Il23r	UTSW	6	67,400,593 (GRCm39)	missense	probably damaging	1.00
R1745:Il23r	UTSW	6	67,443,275 (GRCm39)	missense	probably damaging	0.98
R1887:Il23r	UTSW	6	67,450,785 (GRCm39)	missense	possibly damaging	0.88
R1901:Il23r	UTSW	6	67,400,718 (GRCm39)	missense	probably benign	0.44
R1902:Il23r	UTSW	6	67,400,718 (GRCm39)	missense	probably benign	0.44
R1928:Il23r	UTSW	6	67,400,719 (GRCm39)	missense	possibly damaging	0.79
R1984:Il23r	UTSW	6	67,467,652 (GRCm39)	splice site	probably null
R1985:Il23r	UTSW	6	67,467,652 (GRCm39)	splice site	probably null
R2264:Il23r	UTSW	6	67,403,651 (GRCm39)	critical splice acceptor site	probably null
R2290:Il23r	UTSW	6	67,400,845 (GRCm39)	missense	probably benign	0.17
R2363:Il23r	UTSW	6	67,429,401 (GRCm39)	missense	probably benign	0.08
R3430:Il23r	UTSW	6	67,429,458 (GRCm39)	missense	probably benign	0.08
R3964:Il23r	UTSW	6	67,443,281 (GRCm39)	missense	probably benign	0.13
R4073:Il23r	UTSW	6	67,463,106 (GRCm39)	missense	probably damaging	1.00
R4164:Il23r	UTSW	6	67,400,647 (GRCm39)	missense	probably benign	0.00
R4643:Il23r	UTSW	6	67,400,977 (GRCm39)	missense	probably benign	0.08
R4700:Il23r	UTSW	6	67,450,834 (GRCm39)	missense	probably damaging	1.00
R4703:Il23r	UTSW	6	67,467,686 (GRCm39)	missense	probably damaging	1.00
R4720:Il23r	UTSW	6	67,400,645 (GRCm39)	missense	probably damaging	1.00
R4828:Il23r	UTSW	6	67,408,635 (GRCm39)	missense	probably benign	0.31
R4911:Il23r	UTSW	6	67,400,545 (GRCm39)	missense	probably benign	0.17
R5119:Il23r	UTSW	6	67,443,300 (GRCm39)	missense	probably damaging	1.00
R5152:Il23r	UTSW	6	67,400,725 (GRCm39)	missense	probably damaging	0.98
R5223:Il23r	UTSW	6	67,463,154 (GRCm39)	missense	probably benign	0.23
R5271:Il23r	UTSW	6	67,400,680 (GRCm39)	missense	probably benign	0.16
R5330:Il23r	UTSW	6	67,400,479 (GRCm39)	missense	probably damaging	1.00
R5331:Il23r	UTSW	6	67,400,479 (GRCm39)	missense	probably damaging	1.00
R5384:Il23r	UTSW	6	67,463,275 (GRCm39)	missense	probably benign	0.10
R5874:Il23r	UTSW	6	67,408,629 (GRCm39)	missense	possibly damaging	0.92
R6037:Il23r	UTSW	6	67,455,938 (GRCm39)	missense	probably damaging	0.99
R6037:Il23r	UTSW	6	67,455,938 (GRCm39)	missense	probably damaging	0.99
R6377:Il23r	UTSW	6	67,400,636 (GRCm39)	missense	probably damaging	0.99
R6925:Il23r	UTSW	6	67,400,477 (GRCm39)	missense	probably damaging	1.00
R6975:Il23r	UTSW	6	67,400,352 (GRCm39)	missense	probably damaging	1.00
R7529:Il23r	UTSW	6	67,467,720 (GRCm39)	missense	possibly damaging	0.84
R7757:Il23r	UTSW	6	67,400,965 (GRCm39)	missense	probably benign	0.02
R7832:Il23r	UTSW	6	67,400,846 (GRCm39)	missense	probably benign	0.08
R7946:Il23r	UTSW	6	67,411,648 (GRCm39)	missense	possibly damaging	0.69
R8078:Il23r	UTSW	6	67,400,577 (GRCm39)	missense	probably damaging	0.99
R8391:Il23r	UTSW	6	67,429,374 (GRCm39)	missense	probably benign	0.27
R8784:Il23r	UTSW	6	67,443,401 (GRCm39)	missense	probably damaging	1.00
R9280:Il23r	UTSW	6	67,429,410 (GRCm39)	missense	probably damaging	1.00
R9352:Il23r	UTSW	6	67,403,592 (GRCm39)	missense	probably damaging	0.98
R9362:Il23r	UTSW	6	67,400,384 (GRCm39)	missense	probably damaging	1.00
R9768:Il23r	UTSW	6	67,408,603 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACAAGCTGTAGAATTGCCCC -3'
(R):5'- ACACTGACAAGGCAGCTCACTTTC -3'

Sequencing Primer
(F):5'- AGAGACTTGCCGTTCATCAG -3'
(R):5'- AGGCAGCTCACTTTCAGTAATCTG -3'

Posted On

2014-02-18