Incidental Mutation 'R1328:Il23r'
ID157276
Institutional Source Beutler Lab
Gene Symbol Il23r
Ensembl Gene ENSMUSG00000049093
Gene Nameinterleukin 23 receptor
Synonyms
MMRRC Submission 039394-MU
Accession Numbers

Ncbi RefSeq: NM_144548.1; MGI:2181693

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R1328 (G1)
Quality Score200
Status Validated
Chromosome6
Chromosomal Location67422932-67491855 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 67491818 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118364]
Predicted Effect probably benign
Transcript: ENSMUST00000118364
SMART Domains Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093

DomainStartEndE-ValueType
FN3 140 220 1e-1 SMART
Blast:FN3 235 317 2e-38 BLAST
transmembrane domain 388 410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.9%
Validation Efficiency 100% (37/37)
MGI Phenotype Strain: 4355925
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 C T 7: 44,257,092 probably null Het
Bcap29 T C 12: 31,630,808 I60V probably benign Het
Ccdc71 T A 9: 108,462,949 probably benign Het
Ccnb1ip1 A T 14: 50,789,925 V240E probably benign Het
Copa C T 1: 172,121,691 probably benign Het
Dmxl2 G T 9: 54,396,249 Q2314K probably benign Het
Fam181b T C 7: 93,080,229 I70T probably damaging Het
Fbxl14 T C 6: 119,480,386 L176P possibly damaging Het
Fip1l1 T A 5: 74,546,135 F144L possibly damaging Het
Flnc T C 6: 29,438,613 W169R probably damaging Het
H2-M3 T C 17: 37,271,034 V127A possibly damaging Het
Krt18 C T 15: 102,030,734 A251V probably benign Het
Mast1 A G 8: 84,917,988 probably benign Het
Olfr1499 G A 19: 13,815,536 T18I probably benign Het
Olfr771 A G 10: 129,160,424 S187P possibly damaging Het
Pkhd1l1 T C 15: 44,497,996 Y481H probably benign Het
Polr3e C T 7: 120,933,823 probably benign Het
Pou4f2 G A 8: 78,436,130 A92V probably benign Het
Pramel5 A G 4: 144,271,488 L395P probably damaging Het
Prmt9 T C 8: 77,572,654 I659T possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rrp36 T A 17: 46,672,779 K36* probably null Het
Sag G A 1: 87,810,294 probably benign Het
Setd7 T C 3: 51,542,819 Y62C possibly damaging Het
Smr2 AT ATT 5: 88,108,824 probably null Het
Sox13 T C 1: 133,383,817 D559G probably damaging Het
Srd5a1 T A 13: 69,575,191 Y236F probably damaging Het
Stxbp2 A T 8: 3,642,657 I570F possibly damaging Het
Tbc1d31 T C 15: 57,942,463 probably benign Het
Trim33 A G 3: 103,353,597 T1064A possibly damaging Het
Vmn1r8 T C 6: 57,036,293 S110P possibly damaging Het
Vmn2r118 C A 17: 55,608,620 M443I probably benign Het
Other mutations in Il23r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Il23r APN 6 67423628 missense probably damaging 0.96
IGL00886:Il23r APN 6 67473890 missense possibly damaging 0.94
IGL00916:Il23r APN 6 67473931 missense probably damaging 1.00
IGL01102:Il23r APN 6 67423925 missense probably damaging 0.98
IGL01466:Il23r APN 6 67426642 missense probably benign 0.30
IGL01627:Il23r APN 6 67423428 missense probably benign 0.17
IGL02160:Il23r APN 6 67423578 missense probably benign 0.09
IGL02394:Il23r APN 6 67466272 splice site probably benign
IGL02418:Il23r APN 6 67490672 missense possibly damaging 0.46
IGL02818:Il23r APN 6 67486094 critical splice donor site probably null
IGL03230:Il23r APN 6 67423964 missense probably benign 0.31
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0085:Il23r UTSW 6 67486222 missense probably damaging 1.00
R0477:Il23r UTSW 6 67452377 missense probably benign 0.00
R0534:Il23r UTSW 6 67426588 missense probably benign 0.00
R0547:Il23r UTSW 6 67423701 missense probably benign 0.05
R0547:Il23r UTSW 6 67486251 missense possibly damaging 0.57
R0666:Il23r UTSW 6 67434680 missense probably benign 0.08
R0702:Il23r UTSW 6 67466285 missense probably damaging 0.97
R0715:Il23r UTSW 6 67486333 missense possibly damaging 0.63
R1077:Il23r UTSW 6 67473810 missense probably benign 0.40
R1202:Il23r UTSW 6 67478953 missense possibly damaging 0.95
R1378:Il23r UTSW 6 67452410 missense possibly damaging 0.68
R1420:Il23r UTSW 6 67486197 missense probably damaging 1.00
R1475:Il23r UTSW 6 67452296 critical splice donor site probably null
R1628:Il23r UTSW 6 67423609 missense probably damaging 1.00
R1745:Il23r UTSW 6 67466291 missense probably damaging 0.98
R1887:Il23r UTSW 6 67473801 missense possibly damaging 0.88
R1901:Il23r UTSW 6 67423734 missense probably benign 0.44
R1902:Il23r UTSW 6 67423734 missense probably benign 0.44
R1928:Il23r UTSW 6 67423735 missense possibly damaging 0.79
R1984:Il23r UTSW 6 67490668 splice site probably null
R1985:Il23r UTSW 6 67490668 splice site probably null
R2264:Il23r UTSW 6 67426667 critical splice acceptor site probably null
R2290:Il23r UTSW 6 67423861 missense probably benign 0.17
R2363:Il23r UTSW 6 67452417 missense probably benign 0.08
R3430:Il23r UTSW 6 67452474 missense probably benign 0.08
R3964:Il23r UTSW 6 67466297 missense probably benign 0.13
R4073:Il23r UTSW 6 67486122 missense probably damaging 1.00
R4164:Il23r UTSW 6 67423663 missense probably benign 0.00
R4643:Il23r UTSW 6 67423993 missense probably benign 0.08
R4700:Il23r UTSW 6 67473850 missense probably damaging 1.00
R4703:Il23r UTSW 6 67490702 missense probably damaging 1.00
R4720:Il23r UTSW 6 67423661 missense probably damaging 1.00
R4828:Il23r UTSW 6 67431651 missense probably benign 0.31
R4911:Il23r UTSW 6 67423561 missense probably benign 0.17
R5119:Il23r UTSW 6 67466316 missense probably damaging 1.00
R5152:Il23r UTSW 6 67423741 missense probably damaging 0.98
R5223:Il23r UTSW 6 67486170 missense probably benign 0.23
R5271:Il23r UTSW 6 67423696 missense probably benign 0.16
R5330:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5331:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5384:Il23r UTSW 6 67486291 missense probably benign 0.10
R5874:Il23r UTSW 6 67431645 missense possibly damaging 0.92
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6377:Il23r UTSW 6 67423652 missense probably damaging 0.99
R6925:Il23r UTSW 6 67423493 missense probably damaging 1.00
R6975:Il23r UTSW 6 67423368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACAAGCTGTAGAATTGCCCC -3'
(R):5'- ACACTGACAAGGCAGCTCACTTTC -3'

Sequencing Primer
(F):5'- AGAGACTTGCCGTTCATCAG -3'
(R):5'- AGGCAGCTCACTTTCAGTAATCTG -3'
Posted On2014-02-18