Incidental Mutation 'R1371:Smad1'
ID157318
Institutional Source Beutler Lab
Gene Symbol Smad1
Ensembl Gene ENSMUSG00000031681
Gene NameSMAD family member 1
SynonymsMadh1, Smad 1, Madr1
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location79338395-79399518 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 79349578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066091] [ENSMUST00000109885]
Predicted Effect probably benign
Transcript: ENSMUST00000066091
SMART Domains Protein: ENSMUSP00000071035
Gene: ENSMUSG00000031681

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
DWB 269 441 2.73e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109885
SMART Domains Protein: ENSMUSP00000105511
Gene: ENSMUSG00000031681

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
DWB 269 425 3.92e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215983
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired allantois formation resulting in the lack of a placenta, and die around embryonic day 9-10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Smad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Smad1 APN 8 79356469 missense probably damaging 0.97
IGL01792:Smad1 APN 8 79372123 missense probably damaging 1.00
R0395:Smad1 UTSW 8 79349782 missense probably benign 0.01
R0400:Smad1 UTSW 8 79371770 splice site probably benign
R0990:Smad1 UTSW 8 79343788 missense probably damaging 1.00
R1481:Smad1 UTSW 8 79343730 missense probably benign 0.20
R1661:Smad1 UTSW 8 79372029 missense probably damaging 1.00
R1665:Smad1 UTSW 8 79372029 missense probably damaging 1.00
R1797:Smad1 UTSW 8 79343844 missense probably damaging 1.00
R2879:Smad1 UTSW 8 79353455 splice site probably null
R3624:Smad1 UTSW 8 79339698 missense probably benign 0.31
R3791:Smad1 UTSW 8 79339770 missense probably damaging 1.00
R3815:Smad1 UTSW 8 79343730 missense probably benign 0.20
R3819:Smad1 UTSW 8 79343730 missense probably benign 0.20
R4887:Smad1 UTSW 8 79349752 missense probably damaging 1.00
R5438:Smad1 UTSW 8 79356320 missense probably benign 0.19
X0064:Smad1 UTSW 8 79353404 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGAGTACTGCCCACAGTAGCAAG -3'
(R):5'- AGCCAGGTTTACAGTGCGGTTTC -3'

Sequencing Primer
(F):5'- AGTAGCAAGCCACACTATGC -3'
(R):5'- CTTCTTACAGATGTTCAGGCAG -3'
Posted On2014-02-18