Incidental Mutation 'R1371:H2afy2'
ID157325
Institutional Source Beutler Lab
Gene Symbol H2afy2
Ensembl Gene ENSMUSG00000020086
Gene NameH2A histone family, member Y2
SynonymsmacroH2A2
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R1371 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61738665-61784147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61749333 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 177 (D177E)
Ref Sequence ENSEMBL: ENSMUSP00000020283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020283]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020283
AA Change: D177E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020283
Gene: ENSMUSG00000020086
AA Change: D177E

DomainStartEndE-ValueType
H2A 3 120 5.3e-67 SMART
low complexity region 134 151 N/A INTRINSIC
low complexity region 157 167 N/A INTRINSIC
Pfam:Macro 216 330 1.8e-28 PFAM
low complexity region 339 345 N/A INTRINSIC
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and may participate in stable X chromosome inactivation. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele do not exhibit any developmental or reproductive abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Hsh2d A T 8: 72,196,894 probably benign Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in H2afy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:H2afy2 APN 10 61757771 missense probably damaging 0.96
lown UTSW 10 61757835 missense probably damaging 0.99
R0551:H2afy2 UTSW 10 61741166 missense probably damaging 0.99
R4830:H2afy2 UTSW 10 61739353 missense possibly damaging 0.95
R5394:H2afy2 UTSW 10 61751687 missense possibly damaging 0.89
R5541:H2afy2 UTSW 10 61747717 missense probably benign 0.20
R6029:H2afy2 UTSW 10 61747762 missense possibly damaging 0.75
R6498:H2afy2 UTSW 10 61757835 missense probably damaging 0.99
R6735:H2afy2 UTSW 10 61741267 missense probably damaging 0.98
R7139:H2afy2 UTSW 10 61757895 start codon destroyed not run
Predicted Primers PCR Primer
(F):5'- TCCTCTAGGCAGACTTTAGGCTGAC -3'
(R):5'- AGCCACATTCACTGAGAACAGATCG -3'

Sequencing Primer
(F):5'- AGACTTTAGGCTGACCTAACG -3'
(R):5'- TTCACTGAGAACAGATCGTCCAG -3'
Posted On2014-02-18