Incidental Mutation 'R1372:Mpp3'
ID157375
Institutional Source Beutler Lab
Gene Symbol Mpp3
Ensembl Gene ENSMUSG00000052373
Gene Namemembrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
SynonymsDlgh3
MMRRC Submission 039436-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1372 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101999652-102028461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102000575 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 579 (V579A)
Ref Sequence ENSEMBL: ENSMUSP00000102786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062801] [ENSMUST00000100400] [ENSMUST00000107168]
Predicted Effect probably damaging
Transcript: ENSMUST00000062801
AA Change: V579A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055469
Gene: ENSMUSG00000052373
AA Change: V579A

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100400
AA Change: V579A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097969
Gene: ENSMUSG00000052373
AA Change: V579A

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107168
AA Change: V579A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102786
Gene: ENSMUSG00000052373
AA Change: V579A

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132094
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. This protein contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. Alternatively spliced transcript variants have been identified. One transcript variant is experimentally supported, but it doesn't encode a protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,957 Q137L possibly damaging Het
Abca12 A G 1: 71,294,857 I1162T probably damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Adgre5 G A 8: 83,728,320 P248S probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Asxl3 T G 18: 22,410,009 S20A probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Car10 A T 11: 93,578,699 T167S probably benign Het
Cbx7 C T 15: 79,918,873 G160R probably damaging Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Cd209d C A 8: 3,878,515 probably benign Het
Cdca4 G A 12: 112,821,917 Q64* probably null Het
Cela2a C T 4: 141,819,094 G178D probably damaging Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Crmp1 G A 5: 37,288,811 G604R probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cxcr1 T C 1: 74,192,002 D287G probably benign Het
Cyp4a12b T C 4: 115,432,949 I233T probably benign Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dsg4 C A 18: 20,449,676 probably null Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Hmcn1 A T 1: 150,680,715 M2440K probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Mphosph9 A T 5: 124,283,745 probably null Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pdgfra A G 5: 75,189,263 E936G probably damaging Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Plekhg5 G A 4: 152,104,731 R243H probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Rhcg A T 7: 79,599,374 D366E probably benign Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Other mutations in Mpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Mpp3 APN 11 102002103 missense possibly damaging 0.76
IGL01337:Mpp3 APN 11 102000585 missense probably benign
IGL01393:Mpp3 APN 11 102025478 missense probably damaging 0.99
IGL01544:Mpp3 APN 11 102018659 missense possibly damaging 0.91
IGL02152:Mpp3 APN 11 102025390 nonsense probably null
IGL02441:Mpp3 APN 11 102009675 missense probably benign 0.00
IGL02656:Mpp3 APN 11 102008601 missense probably benign
R0013:Mpp3 UTSW 11 102005425 missense probably benign 0.27
R0117:Mpp3 UTSW 11 102000573 missense probably damaging 1.00
R0564:Mpp3 UTSW 11 102005347 missense possibly damaging 0.87
R1531:Mpp3 UTSW 11 102008649 missense probably benign
R1639:Mpp3 UTSW 11 102023442 missense probably damaging 1.00
R1720:Mpp3 UTSW 11 102025756 start codon destroyed possibly damaging 0.79
R1968:Mpp3 UTSW 11 102018552 intron probably benign
R2064:Mpp3 UTSW 11 102000690 missense probably benign 0.01
R2363:Mpp3 UTSW 11 102020486 missense probably damaging 1.00
R3775:Mpp3 UTSW 11 102023367 nonsense probably null
R3776:Mpp3 UTSW 11 102023367 nonsense probably null
R4208:Mpp3 UTSW 11 102000600 missense probably benign
R4287:Mpp3 UTSW 11 102023463 missense probably damaging 1.00
R4327:Mpp3 UTSW 11 102023511 intron probably benign
R4329:Mpp3 UTSW 11 102023511 intron probably benign
R4367:Mpp3 UTSW 11 102023420 missense probably benign 0.01
R4856:Mpp3 UTSW 11 102025136 missense probably benign
R4886:Mpp3 UTSW 11 102025136 missense probably benign
R4904:Mpp3 UTSW 11 102000587 missense probably benign 0.01
R4946:Mpp3 UTSW 11 102005022 missense probably benign 0.01
R5405:Mpp3 UTSW 11 102010221 missense probably benign
R5935:Mpp3 UTSW 11 102025415 missense probably damaging 1.00
R6020:Mpp3 UTSW 11 102018539 intron probably benign
R6056:Mpp3 UTSW 11 102011689 intron probably null
R6151:Mpp3 UTSW 11 102008566 missense probably benign 0.11
R6677:Mpp3 UTSW 11 102008618 missense probably benign
R6784:Mpp3 UTSW 11 102002148 critical splice acceptor site probably null
R6855:Mpp3 UTSW 11 102013325 missense probably benign 0.09
R7227:Mpp3 UTSW 11 102005078 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACACGCTATTCTGTGGACTGCCC -3'
(R):5'- TGGCTCTCGGCTCATAGATCTTTGG -3'

Sequencing Primer
(F):5'- TTCAGCTCCGCTCGTGAAG -3'
(R):5'- ACTCTCGTGTTCACAGTTAAGG -3'
Posted On2014-02-18