Incidental Mutation 'R1372:Cbx7'
ID157381
Institutional Source Beutler Lab
Gene Symbol Cbx7
Ensembl Gene ENSMUSG00000053411
Gene Namechromobox 7
SynonymsD15Ertd417e, 1600014J01Rik
MMRRC Submission 039436-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R1372 (G1)
Quality Score219
Status Not validated
Chromosome15
Chromosomal Location79915807-79971119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79918873 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 160 (G160R)
Ref Sequence ENSEMBL: ENSMUSP00000086708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089293] [ENSMUST00000109615] [ENSMUST00000109616] [ENSMUST00000128931] [ENSMUST00000132821] [ENSMUST00000146719] [ENSMUST00000177044] [ENSMUST00000177098]
Predicted Effect probably damaging
Transcript: ENSMUST00000089293
AA Change: G160R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086708
Gene: ENSMUSG00000053411
AA Change: G160R

DomainStartEndE-ValueType
CHROMO 10 62 3.12e-18 SMART
low complexity region 68 85 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
PDB:3GS2|D 219 248 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109615
SMART Domains Protein: ENSMUSP00000105244
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
CHROMO 10 62 3.12e-18 SMART
low complexity region 70 81 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
PDB:3GS2|D 126 155 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109616
SMART Domains Protein: ENSMUSP00000105245
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
CHROMO 10 62 3.12e-18 SMART
low complexity region 70 81 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
PDB:3GS2|D 126 155 1e-12 PDB
Predicted Effect unknown
Transcript: ENSMUST00000128931
AA Change: G47R
SMART Domains Protein: ENSMUSP00000118813
Gene: ENSMUSG00000053411
AA Change: G47R

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132821
SMART Domains Protein: ENSMUSP00000118871
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146719
SMART Domains Protein: ENSMUSP00000120748
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
CHROMO 2 84 4.03e-12 SMART
low complexity region 92 103 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
PDB:3GS2|D 148 177 6e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176639
Predicted Effect probably benign
Transcript: ENSMUST00000177044
SMART Domains Protein: ENSMUSP00000135246
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
CHROMO 10 56 3.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177098
SMART Domains Protein: ENSMUSP00000135079
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 31 209 6.8e-37 PFAM
Pfam:APOBEC_C 147 201 6e-23 PFAM
Pfam:APOBEC_N 216 386 1.2e-27 PFAM
Pfam:APOBEC_C 325 378 3.1e-21 PFAM
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the CHROMO (CHRomatin Organization MOdifier) domain. The encoded protein is a component of the Polycomb repressive complex 1 (PRC1), and is thought to control the lifespan of several normal human cells. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body length and develop liver and lung adenomas and carcinomas while mutant embryonic fibriblasts show a higher growth rate and reduced susceptibility to senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T A 8: 116,971,957 Q137L possibly damaging Het
Abca12 A G 1: 71,294,857 I1162T probably damaging Het
Adcy2 T A 13: 68,668,533 N778I probably damaging Het
Adgre5 G A 8: 83,728,320 P248S probably damaging Het
Akap13 G A 7: 75,609,592 G655S possibly damaging Het
Ankrd28 A T 14: 31,745,261 M248K probably benign Het
Asxl3 T G 18: 22,410,009 S20A probably benign Het
Atf7ip2 G A 16: 10,234,331 V225I probably damaging Het
Car10 A T 11: 93,578,699 T167S probably benign Het
Ccdc151 C T 9: 21,993,620 R290H probably damaging Het
Cd209d C A 8: 3,878,515 probably benign Het
Cdca4 G A 12: 112,821,917 Q64* probably null Het
Cela2a C T 4: 141,819,094 G178D probably damaging Het
Cntnap5b G A 1: 100,164,088 D499N probably benign Het
Cox7a2 G A 9: 79,758,537 R21* probably null Het
Crmp1 G A 5: 37,288,811 G604R probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cxcr1 T C 1: 74,192,002 D287G probably benign Het
Cyp4a12b T C 4: 115,432,949 I233T probably benign Het
Dlg1 T C 16: 31,812,820 I208T probably damaging Het
Dsg4 C A 18: 20,449,676 probably null Het
Epha3 A G 16: 63,611,053 I495T possibly damaging Het
Gm4778 A G 3: 94,266,128 T148A possibly damaging Het
Hmcn1 A T 1: 150,680,715 M2440K probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Leo1 T C 9: 75,449,469 V377A possibly damaging Het
Lsg1 A G 16: 30,564,654 F583L possibly damaging Het
Mphosph9 A T 5: 124,283,745 probably null Het
Mpp3 A G 11: 102,000,575 V579A probably damaging Het
Oca2 T A 7: 56,535,968 M814K probably benign Het
Pdgfra A G 5: 75,189,263 E936G probably damaging Het
Pkd1 T C 17: 24,575,266 C1976R probably damaging Het
Plekhg5 G A 4: 152,104,731 R243H probably damaging Het
Pogz T A 3: 94,860,888 L126M probably damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rec8 T C 14: 55,618,974 Y68H probably damaging Het
Rhcg A T 7: 79,599,374 D366E probably benign Het
Ryr3 T A 2: 112,834,201 S1582C probably damaging Het
Sh3pxd2a A T 19: 47,267,721 W853R probably damaging Het
Tnxb T C 17: 34,710,293 V2770A possibly damaging Het
Vmn2r63 A G 7: 42,929,218 F84L possibly damaging Het
Other mutations in Cbx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Cbx7 APN 15 79930628 missense probably damaging 1.00
IGL02601:Cbx7 APN 15 79923470 critical splice donor site probably null
IGL02798:Cbx7 APN 15 79918399 missense probably damaging 1.00
R1373:Cbx7 UTSW 15 79918873 missense probably damaging 1.00
R1985:Cbx7 UTSW 15 79918390 missense probably damaging 1.00
R2240:Cbx7 UTSW 15 79918357 missense probably damaging 1.00
R6371:Cbx7 UTSW 15 79918822 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCAGTCAGAAGTCGTGAATGGTAGC -3'
(R):5'- AGACAAGGCCCACGTTTGAGAC -3'

Sequencing Primer
(F):5'- CACGCTTGAAGCAGGATGC -3'
(R):5'- TGCCAATGAGGCTGAGTATATCC -3'
Posted On2014-02-18