Incidental Mutation 'R1373:Cbx7'
ID157417
Institutional Source Beutler Lab
Gene Symbol Cbx7
Ensembl Gene ENSMUSG00000053411
Gene Namechromobox 7
SynonymsD15Ertd417e, 1600014J01Rik
MMRRC Submission 039437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R1373 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79915807-79971119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79918873 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 160 (G160R)
Ref Sequence ENSEMBL: ENSMUSP00000086708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089293] [ENSMUST00000109615] [ENSMUST00000109616] [ENSMUST00000128931] [ENSMUST00000132821] [ENSMUST00000146719] [ENSMUST00000177044] [ENSMUST00000177098]
Predicted Effect probably damaging
Transcript: ENSMUST00000089293
AA Change: G160R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086708
Gene: ENSMUSG00000053411
AA Change: G160R

DomainStartEndE-ValueType
CHROMO 10 62 3.12e-18 SMART
low complexity region 68 85 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
PDB:3GS2|D 219 248 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109615
SMART Domains Protein: ENSMUSP00000105244
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
CHROMO 10 62 3.12e-18 SMART
low complexity region 70 81 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
PDB:3GS2|D 126 155 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109616
SMART Domains Protein: ENSMUSP00000105245
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
CHROMO 10 62 3.12e-18 SMART
low complexity region 70 81 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
PDB:3GS2|D 126 155 1e-12 PDB
Predicted Effect unknown
Transcript: ENSMUST00000128931
AA Change: G47R
SMART Domains Protein: ENSMUSP00000118813
Gene: ENSMUSG00000053411
AA Change: G47R

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 77 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132821
SMART Domains Protein: ENSMUSP00000118871
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146719
SMART Domains Protein: ENSMUSP00000120748
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
CHROMO 2 84 4.03e-12 SMART
low complexity region 92 103 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
PDB:3GS2|D 148 177 6e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176639
Predicted Effect probably benign
Transcript: ENSMUST00000177044
SMART Domains Protein: ENSMUSP00000135246
Gene: ENSMUSG00000053411

DomainStartEndE-ValueType
CHROMO 10 56 3.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177098
SMART Domains Protein: ENSMUSP00000135079
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 31 209 6.8e-37 PFAM
Pfam:APOBEC_C 147 201 6e-23 PFAM
Pfam:APOBEC_N 216 386 1.2e-27 PFAM
Pfam:APOBEC_C 325 378 3.1e-21 PFAM
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.2%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the CHROMO (CHRomatin Organization MOdifier) domain. The encoded protein is a component of the Polycomb repressive complex 1 (PRC1), and is thought to control the lifespan of several normal human cells. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body length and develop liver and lung adenomas and carcinomas while mutant embryonic fibriblasts show a higher growth rate and reduced susceptibility to senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 G A 14: 68,570,951 R317C probably damaging Het
Adgrl1 T C 8: 83,937,763 V1261A probably benign Het
Btla G A 16: 45,224,420 G23D probably benign Het
Card19 T C 13: 49,203,964 D110G probably damaging Het
Ccng2 C T 5: 93,271,055 probably benign Het
Col4a3 G A 1: 82,690,087 probably benign Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cps1 A G 1: 67,229,424 N1437S possibly damaging Het
Dcaf1 A G 9: 106,857,880 I676V probably benign Het
Dnah5 T A 15: 28,313,918 probably benign Het
Dock1 T C 7: 135,167,175 S1758P probably benign Het
Furin C T 7: 80,392,184 probably benign Het
Ice2 G A 9: 69,407,119 R50H probably benign Het
Ifi207 T A 1: 173,730,347 D275V unknown Het
Nrxn2 C T 19: 6,472,301 T190M probably damaging Het
Olfr699 C T 7: 106,790,756 V82I probably benign Het
Olfr761 T C 17: 37,952,360 I221M probably damaging Het
Pcnx3 A G 19: 5,665,516 L1494P probably damaging Het
Pitrm1 G T 13: 6,570,700 M739I probably benign Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Sfr1 C G 19: 47,734,916 D286E possibly damaging Het
Slx4 A G 16: 3,985,510 S1147P probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgfbr3 T C 5: 107,214,943 I68V probably benign Het
Tpmt A C 13: 47,027,258 probably null Het
Trpm5 A G 7: 143,086,842 probably benign Het
Ttc25 T C 11: 100,545,832 F11S probably damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp25 T C 16: 77,062,385 probably benign Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vps13c A T 9: 67,927,511 K1707N probably damaging Het
Other mutations in Cbx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Cbx7 APN 15 79930628 missense probably damaging 1.00
IGL02601:Cbx7 APN 15 79923470 critical splice donor site probably null
IGL02798:Cbx7 APN 15 79918399 missense probably damaging 1.00
R1372:Cbx7 UTSW 15 79918873 missense probably damaging 1.00
R1985:Cbx7 UTSW 15 79918390 missense probably damaging 1.00
R2240:Cbx7 UTSW 15 79918357 missense probably damaging 1.00
R6371:Cbx7 UTSW 15 79918822 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCAGTCAGAAGTCGTGAATGGTAGC -3'
(R):5'- AGACAAGGCCCACGTTTGAGAC -3'

Sequencing Primer
(F):5'- CACGCTTGAAGCAGGATGC -3'
(R):5'- TGCCAATGAGGCTGAGTATATCC -3'
Posted On2014-02-18