Incidental Mutation 'R1373:Slx4'
ID157418
Institutional Source Beutler Lab
Gene Symbol Slx4
Ensembl Gene ENSMUSG00000039738
Gene NameSLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
SynonymsBtbd12, D16Bwg1016e
MMRRC Submission 039437-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1373 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3979105-4003770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3985510 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1147 (S1147P)
Ref Sequence ENSEMBL: ENSMUSP00000038871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040790]
Predicted Effect probably benign
Transcript: ENSMUST00000040790
AA Change: S1147P

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: S1147P

DomainStartEndE-ValueType
low complexity region 400 413 N/A INTRINSIC
BTB 506 609 6.15e-7 SMART
low complexity region 651 667 N/A INTRINSIC
low complexity region 833 849 N/A INTRINSIC
low complexity region 857 875 N/A INTRINSIC
low complexity region 1176 1192 N/A INTRINSIC
low complexity region 1437 1461 N/A INTRINSIC
Pfam:Slx4 1484 1541 3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145706
Predicted Effect probably benign
Transcript: ENSMUST00000146569
SMART Domains Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738

DomainStartEndE-ValueType
Pfam:BTB 6 102 6.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156542
Meta Mutation Damage Score 0.01 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.2%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 G A 14: 68,570,951 R317C probably damaging Het
Adgrl1 T C 8: 83,937,763 V1261A probably benign Het
Btla G A 16: 45,224,420 G23D probably benign Het
Card19 T C 13: 49,203,964 D110G probably damaging Het
Cbx7 C T 15: 79,918,873 G160R probably damaging Het
Ccng2 C T 5: 93,271,055 probably benign Het
Col4a3 G A 1: 82,690,087 probably benign Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cps1 A G 1: 67,229,424 N1437S possibly damaging Het
Dcaf1 A G 9: 106,857,880 I676V probably benign Het
Dnah5 T A 15: 28,313,918 probably benign Het
Dock1 T C 7: 135,167,175 S1758P probably benign Het
Furin C T 7: 80,392,184 probably benign Het
Ice2 G A 9: 69,407,119 R50H probably benign Het
Ifi207 T A 1: 173,730,347 D275V unknown Het
Nrxn2 C T 19: 6,472,301 T190M probably damaging Het
Olfr699 C T 7: 106,790,756 V82I probably benign Het
Olfr761 T C 17: 37,952,360 I221M probably damaging Het
Pcnx3 A G 19: 5,665,516 L1494P probably damaging Het
Pitrm1 G T 13: 6,570,700 M739I probably benign Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Sfr1 C G 19: 47,734,916 D286E possibly damaging Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgfbr3 T C 5: 107,214,943 I68V probably benign Het
Tpmt A C 13: 47,027,258 probably null Het
Trpm5 A G 7: 143,086,842 probably benign Het
Ttc25 T C 11: 100,545,832 F11S probably damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp25 T C 16: 77,062,385 probably benign Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vps13c A T 9: 67,927,511 K1707N probably damaging Het
Other mutations in Slx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Slx4 APN 16 3990888 missense probably benign 0.17
IGL01767:Slx4 APN 16 3990248 missense probably benign 0.01
IGL02525:Slx4 APN 16 3980597 missense probably damaging 1.00
slim UTSW 16 3990910 nonsense probably null
R0033:Slx4 UTSW 16 3988000 missense probably benign 0.08
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0363:Slx4 UTSW 16 3980089 missense probably damaging 1.00
R0433:Slx4 UTSW 16 3986018 missense probably benign 0.01
R0993:Slx4 UTSW 16 3985825 missense probably benign 0.00
R1083:Slx4 UTSW 16 3990910 nonsense probably null
R1710:Slx4 UTSW 16 3999158 missense probably benign 0.15
R1712:Slx4 UTSW 16 3991594 missense probably damaging 0.99
R1874:Slx4 UTSW 16 3986848 missense probably benign 0.25
R1937:Slx4 UTSW 16 3987166 makesense probably null
R2008:Slx4 UTSW 16 3979921 missense probably damaging 1.00
R2156:Slx4 UTSW 16 3986359 missense probably benign 0.00
R2427:Slx4 UTSW 16 3988987 missense probably damaging 0.99
R3765:Slx4 UTSW 16 3980986 missense probably damaging 1.00
R3890:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R3891:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R4465:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4467:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4497:Slx4 UTSW 16 3994909 missense probably damaging 1.00
R4882:Slx4 UTSW 16 3980996 critical splice acceptor site probably null
R5119:Slx4 UTSW 16 4001199 missense possibly damaging 0.89
R5384:Slx4 UTSW 16 3990805 missense probably damaging 1.00
R5472:Slx4 UTSW 16 3991540 missense probably benign 0.13
R5578:Slx4 UTSW 16 3986862 missense probably damaging 1.00
R5582:Slx4 UTSW 16 3985788 missense possibly damaging 0.93
R5696:Slx4 UTSW 16 3979967 missense probably damaging 1.00
R5827:Slx4 UTSW 16 4001284 missense possibly damaging 0.94
R5964:Slx4 UTSW 16 4000951 critical splice donor site probably null
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6345:Slx4 UTSW 16 3990850 missense probably benign 0.06
R6612:Slx4 UTSW 16 3985276 missense probably damaging 0.99
R6979:Slx4 UTSW 16 3985015 missense probably damaging 0.96
R6989:Slx4 UTSW 16 3995838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCATCACTGTGCAAAGCCTC -3'
(R):5'- TAGAACGCAGGACCATGCTGGAAAC -3'

Sequencing Primer
(F):5'- TGAGAGAGGCTCATTCCAAC -3'
(R):5'- ACAGCCCAGCAGTTCTCTG -3'
Posted On2014-02-18