Incidental Mutation 'R1373:Pcnx3'
ID157422
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Namepecanex homolog 3
SynonymsPcnxl3
MMRRC Submission 039437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R1373 (G1)
Quality Score173
Status Validated
Chromosome19
Chromosomal Location5664635-5688908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5665516 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1494 (L1494P)
Ref Sequence ENSEMBL: ENSMUSP00000063786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000113615] [ENSMUST00000164304] [ENSMUST00000169854]
Predicted Effect probably damaging
Transcript: ENSMUST00000068169
AA Change: L1494P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: L1494P

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071857
SMART Domains Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 529 7.2e-64 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080824
SMART Domains Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113615
AA Change: L1902P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: L1902P

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132420
Predicted Effect probably benign
Transcript: ENSMUST00000133136
SMART Domains Protein: ENSMUSP00000123666
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
Pfam:Pecanex_C 1 129 7.9e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146638
Predicted Effect probably benign
Transcript: ENSMUST00000164304
SMART Domains Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169854
SMART Domains Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.2%
Validation Efficiency 94% (34/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 G A 14: 68,570,951 R317C probably damaging Het
Adgrl1 T C 8: 83,937,763 V1261A probably benign Het
Btla G A 16: 45,224,420 G23D probably benign Het
Card19 T C 13: 49,203,964 D110G probably damaging Het
Cbx7 C T 15: 79,918,873 G160R probably damaging Het
Ccng2 C T 5: 93,271,055 probably benign Het
Col4a3 G A 1: 82,690,087 probably benign Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cps1 A G 1: 67,229,424 N1437S possibly damaging Het
Dcaf1 A G 9: 106,857,880 I676V probably benign Het
Dnah5 T A 15: 28,313,918 probably benign Het
Dock1 T C 7: 135,167,175 S1758P probably benign Het
Furin C T 7: 80,392,184 probably benign Het
Ice2 G A 9: 69,407,119 R50H probably benign Het
Ifi207 T A 1: 173,730,347 D275V unknown Het
Nrxn2 C T 19: 6,472,301 T190M probably damaging Het
Olfr699 C T 7: 106,790,756 V82I probably benign Het
Olfr761 T C 17: 37,952,360 I221M probably damaging Het
Pitrm1 G T 13: 6,570,700 M739I probably benign Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Sfr1 C G 19: 47,734,916 D286E possibly damaging Het
Slx4 A G 16: 3,985,510 S1147P probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgfbr3 T C 5: 107,214,943 I68V probably benign Het
Tpmt A C 13: 47,027,258 probably null Het
Trpm5 A G 7: 143,086,842 probably benign Het
Ttc25 T C 11: 100,545,832 F11S probably damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp25 T C 16: 77,062,385 probably benign Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vps13c A T 9: 67,927,511 K1707N probably damaging Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5667259 unclassified probably benign
IGL01667:Pcnx3 APN 19 5686630 missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5667476 missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5665337 nonsense probably null
IGL01791:Pcnx3 APN 19 5673267 missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5677663 missense probably benign
IGL01987:Pcnx3 APN 19 5677479 missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5679386 missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5686481 missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5685395 missense probably damaging 1.00
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0360:Pcnx3 UTSW 19 5665583 missense probably damaging 0.98
R0687:Pcnx3 UTSW 19 5684333 missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5677728 splice site probably benign
R0840:Pcnx3 UTSW 19 5685701 unclassified probably null
R0907:Pcnx3 UTSW 19 5671525 missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5685347 nonsense probably null
R1602:Pcnx3 UTSW 19 5672515 missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5686065 missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5665745 missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5673315 missense probably damaging 1.00
R1889:Pcnx3 UTSW 19 5672656 missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5672587 missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5671556 missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5667605 missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5683339 nonsense probably null
R2358:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R2871:Pcnx3 UTSW 19 5683746 intron probably benign
R3699:Pcnx3 UTSW 19 5672465 missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5683339 nonsense probably null
R3712:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R3798:Pcnx3 UTSW 19 5678668 nonsense probably null
R3856:Pcnx3 UTSW 19 5678967 missense probably benign 0.02
R3953:Pcnx3 UTSW 19 5683780 splice site probably benign
R4613:Pcnx3 UTSW 19 5667219 missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5687130 missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5687995 critical splice donor site probably null
R5338:Pcnx3 UTSW 19 5672596 missense probably damaging 1.00
R5770:Pcnx3 UTSW 19 5681579 intron probably benign
R5950:Pcnx3 UTSW 19 5667158 missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5671680 missense possibly damaging 0.71
R5969:Pcnx3 UTSW 19 5685535 missense probably damaging 1.00
R6543:Pcnx3 UTSW 19 5665247 missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5686487 missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5672615 missense not run
X0028:Pcnx3 UTSW 19 5684427 missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5686622 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCCTCAGGAATACTGCTGTCCAAG -3'
(R):5'- TGGCACACCCTACGCCTGAAAATG -3'

Sequencing Primer
(F):5'- TACTGCTGTCCAAGCAAGG -3'
(R):5'- CAAAGCTGGACTGAGCCTG -3'
Posted On2014-02-18