Incidental Mutation 'R1373:Nrxn2'
ID157423
Institutional Source Beutler Lab
Gene Symbol Nrxn2
Ensembl Gene ENSMUSG00000033768
Gene Nameneurexin II
Synonyms6430591O13Rik, neurexin II beta, neurexin II alpha
MMRRC Submission 039437-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R1373 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6418731-6544169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6472301 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 190 (T190M)
Ref Sequence ENSEMBL: ENSMUSP00000122920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077182] [ENSMUST00000113461] [ENSMUST00000113462] [ENSMUST00000137166] [ENSMUST00000137821]
Predicted Effect probably damaging
Transcript: ENSMUST00000077182
AA Change: T399M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076424
Gene: ENSMUSG00000033768
AA Change: T399M

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 444 1.18e-33 SMART
LamG 498 651 1.51e-40 SMART
EGF 678 712 8.91e-3 SMART
LamG 737 875 4.91e-22 SMART
LamG 923 1059 1.08e-41 SMART
EGF 1084 1118 1.91e1 SMART
LamG 1146 1303 4.48e-16 SMART
low complexity region 1332 1362 N/A INTRINSIC
low complexity region 1430 1445 N/A INTRINSIC
4.1m 1448 1466 3.75e-4 SMART
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113461
AA Change: T383M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109088
Gene: ENSMUSG00000033768
AA Change: T383M

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
LamG 286 428 8.4e-30 SMART
LamG 482 635 1.51e-40 SMART
EGF 662 696 8.91e-3 SMART
LamG 721 850 2.36e-24 SMART
LamG 898 1034 1.08e-41 SMART
EGF 1059 1093 1.91e1 SMART
LamG 1121 1248 1.26e-19 SMART
low complexity region 1277 1307 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
low complexity region 1567 1582 N/A INTRINSIC
4.1m 1585 1603 3.75e-4 SMART
low complexity region 1617 1636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113462
AA Change: T407M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109089
Gene: ENSMUSG00000033768
AA Change: T407M

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 452 8.4e-30 SMART
LamG 506 659 1.51e-40 SMART
EGF 686 720 8.91e-3 SMART
LamG 745 883 4.91e-22 SMART
LamG 931 1067 1.08e-41 SMART
EGF 1092 1126 1.91e1 SMART
LamG 1154 1311 4.48e-16 SMART
low complexity region 1340 1370 N/A INTRINSIC
low complexity region 1426 1447 N/A INTRINSIC
low complexity region 1630 1645 N/A INTRINSIC
4.1m 1648 1666 3.75e-4 SMART
low complexity region 1680 1699 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124815
Predicted Effect probably damaging
Transcript: ENSMUST00000137166
AA Change: T414M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119762
Gene: ENSMUSG00000033768
AA Change: T414M

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 459 8.87e-29 SMART
LamG 513 666 1.51e-40 SMART
EGF 693 727 8.91e-3 SMART
LamG 752 890 4.91e-22 SMART
LamG 938 1074 1.08e-41 SMART
EGF 1099 1133 1.91e1 SMART
LamG 1161 1318 4.48e-16 SMART
low complexity region 1347 1377 N/A INTRINSIC
low complexity region 1433 1454 N/A INTRINSIC
low complexity region 1637 1652 N/A INTRINSIC
4.1m 1655 1673 3.75e-4 SMART
low complexity region 1687 1706 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137821
AA Change: T190M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122920
Gene: ENSMUSG00000033768
AA Change: T190M

DomainStartEndE-ValueType
EGF 6 43 1.73e1 SMART
low complexity region 59 67 N/A INTRINSIC
LamG 101 212 1.63e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150792
Predicted Effect unknown
Transcript: ENSMUST00000155158
AA Change: T159M
SMART Domains Protein: ENSMUSP00000118878
Gene: ENSMUSG00000033768
AA Change: T159M

DomainStartEndE-ValueType
Blast:LamG 2 45 8e-7 BLAST
LamG 71 205 1.18e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157014
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.2%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin gene family. The products of these genes function as cell adhesion molecules and receptors in the vertebrate nervous system. These genes utilize two promoters. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms while a smaller number of transcripts are produced from the downstream promoter and encode beta-neuresin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. Alternative splicing and the use of alternative promoters may generate thousands of transcript variants (PMID: 12036300, PMID: 11944992).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are generally non-viable; surviving homozygotes show a 30-40% decrease in body weight and their inhibitory postsynaptic currents (IPSCs) are decreased in cortical slice cultures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 G A 14: 68,570,951 R317C probably damaging Het
Adgrl1 T C 8: 83,937,763 V1261A probably benign Het
Btla G A 16: 45,224,420 G23D probably benign Het
Card19 T C 13: 49,203,964 D110G probably damaging Het
Cbx7 C T 15: 79,918,873 G160R probably damaging Het
Ccng2 C T 5: 93,271,055 probably benign Het
Col4a3 G A 1: 82,690,087 probably benign Het
Colgalt2 A G 1: 152,473,161 T186A probably damaging Het
Cps1 A G 1: 67,229,424 N1437S possibly damaging Het
Dcaf1 A G 9: 106,857,880 I676V probably benign Het
Dnah5 T A 15: 28,313,918 probably benign Het
Dock1 T C 7: 135,167,175 S1758P probably benign Het
Furin C T 7: 80,392,184 probably benign Het
Ice2 G A 9: 69,407,119 R50H probably benign Het
Ifi207 T A 1: 173,730,347 D275V unknown Het
Olfr699 C T 7: 106,790,756 V82I probably benign Het
Olfr761 T C 17: 37,952,360 I221M probably damaging Het
Pcnx3 A G 19: 5,665,516 L1494P probably damaging Het
Pitrm1 G T 13: 6,570,700 M739I probably benign Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Sfr1 C G 19: 47,734,916 D286E possibly damaging Het
Slx4 A G 16: 3,985,510 S1147P probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgfbr3 T C 5: 107,214,943 I68V probably benign Het
Tpmt A C 13: 47,027,258 probably null Het
Trpm5 A G 7: 143,086,842 probably benign Het
Ttc25 T C 11: 100,545,832 F11S probably damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp25 T C 16: 77,062,385 probably benign Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Vps13c A T 9: 67,927,511 K1707N probably damaging Het
Other mutations in Nrxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nrxn2 APN 19 6473593 missense possibly damaging 0.84
IGL01020:Nrxn2 APN 19 6493443 missense probably benign 0.02
IGL01064:Nrxn2 APN 19 6517053 missense probably damaging 0.97
IGL01561:Nrxn2 APN 19 6490142 missense probably damaging 1.00
IGL01759:Nrxn2 APN 19 6509929 missense probably damaging 1.00
IGL02071:Nrxn2 APN 19 6481753 missense probably damaging 1.00
IGL02085:Nrxn2 APN 19 6492868 missense possibly damaging 0.83
IGL02132:Nrxn2 APN 19 6472276 missense probably damaging 1.00
IGL02476:Nrxn2 APN 19 6454985 missense probably damaging 1.00
IGL02605:Nrxn2 APN 19 6450580 missense probably benign 0.02
IGL03123:Nrxn2 APN 19 6481737 missense probably damaging 0.98
IGL03288:Nrxn2 APN 19 6490696 missense probably damaging 1.00
PIT4687001:Nrxn2 UTSW 19 6481308 missense probably benign 0.06
R0019:Nrxn2 UTSW 19 6509957 splice site probably benign
R0257:Nrxn2 UTSW 19 6490698 missense possibly damaging 0.81
R0305:Nrxn2 UTSW 19 6519283 missense probably damaging 1.00
R0453:Nrxn2 UTSW 19 6491521 missense probably damaging 1.00
R0512:Nrxn2 UTSW 19 6517198 missense probably damaging 1.00
R0539:Nrxn2 UTSW 19 6493404 missense probably damaging 0.99
R0571:Nrxn2 UTSW 19 6473533 missense probably damaging 1.00
R1434:Nrxn2 UTSW 19 6443612 intron probably null
R1454:Nrxn2 UTSW 19 6481446 missense probably damaging 0.98
R1671:Nrxn2 UTSW 19 6473750 missense probably damaging 1.00
R1692:Nrxn2 UTSW 19 6519268 missense probably damaging 1.00
R1858:Nrxn2 UTSW 19 6488795 missense probably benign 0.01
R1859:Nrxn2 UTSW 19 6488795 missense probably benign 0.01
R2153:Nrxn2 UTSW 19 6504914 missense probably damaging 1.00
R2196:Nrxn2 UTSW 19 6490109 missense probably damaging 1.00
R2209:Nrxn2 UTSW 19 6493007 missense probably benign 0.01
R2278:Nrxn2 UTSW 19 6481853 missense probably damaging 1.00
R2441:Nrxn2 UTSW 19 6428301 missense probably damaging 1.00
R3897:Nrxn2 UTSW 19 6519257 missense probably damaging 1.00
R3943:Nrxn2 UTSW 19 6473335 missense probably damaging 1.00
R4091:Nrxn2 UTSW 19 6473414 missense probably damaging 1.00
R4162:Nrxn2 UTSW 19 6532143 missense probably damaging 1.00
R4164:Nrxn2 UTSW 19 6532143 missense probably damaging 1.00
R4495:Nrxn2 UTSW 19 6531399 missense probably benign 0.05
R4599:Nrxn2 UTSW 19 6455252 missense probably damaging 0.98
R4735:Nrxn2 UTSW 19 6498454 missense possibly damaging 0.86
R4757:Nrxn2 UTSW 19 6509821 missense probably damaging 1.00
R4890:Nrxn2 UTSW 19 6448278 missense possibly damaging 0.90
R5052:Nrxn2 UTSW 19 6455204 missense probably damaging 1.00
R5311:Nrxn2 UTSW 19 6531398 missense probably benign 0.05
R5330:Nrxn2 UTSW 19 6490081 missense probably damaging 0.96
R5331:Nrxn2 UTSW 19 6490081 missense probably damaging 0.96
R5530:Nrxn2 UTSW 19 6498367 missense possibly damaging 0.93
R5556:Nrxn2 UTSW 19 6490091 missense probably damaging 1.00
R5763:Nrxn2 UTSW 19 6531339 missense probably benign 0.15
R5829:Nrxn2 UTSW 19 6490849 missense probably benign 0.03
R5988:Nrxn2 UTSW 19 6492871 missense possibly damaging 0.83
R6003:Nrxn2 UTSW 19 6498328 missense possibly damaging 0.93
R6032:Nrxn2 UTSW 19 6517132 missense probably damaging 1.00
R6032:Nrxn2 UTSW 19 6517132 missense probably damaging 1.00
R6288:Nrxn2 UTSW 19 6490561 missense probably damaging 1.00
R6334:Nrxn2 UTSW 19 6531292 unclassified probably null
R6373:Nrxn2 UTSW 19 6509830 missense probably damaging 1.00
R6397:Nrxn2 UTSW 19 6532122 missense probably damaging 1.00
R6669:Nrxn2 UTSW 19 6481191 missense probably damaging 1.00
R6980:Nrxn2 UTSW 19 6450579 missense probably benign 0.04
R6985:Nrxn2 UTSW 19 6481245 missense probably damaging 1.00
X0022:Nrxn2 UTSW 19 6509917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATCAAATCTCGGGCTGTTTCC -3'
(R):5'- CAGACTAAATCACAGGGCAGGCTG -3'

Sequencing Primer
(F):5'- TGTTCCGCCTCCAAGACAAG -3'
(R):5'- GGCCAACCACAGCCCTAC -3'
Posted On2014-02-18