Incidental Mutation 'R1375:Thsd7b'
ID157462
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Namethrombospondin, type I, domain containing 7B
Synonyms1700074E13Rik, D130067I03Rik
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1375 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location129273302-130219278 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130159686 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1180 (N1180I)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073527]
Predicted Effect probably damaging
Transcript: ENSMUST00000073527
AA Change: N1180I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: N1180I

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151700
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129595834 missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130165077 missense probably benign 0.00
IGL00987:Thsd7b APN 1 129613279 missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129596146 missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129776334 missense probably benign 0.29
IGL01535:Thsd7b APN 1 129678217 missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130218181 utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129430928 missense probably benign 0.07
IGL01775:Thsd7b APN 1 129628939 missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129816682 missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129595771 missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130159632 missense probably benign 0.01
IGL02404:Thsd7b APN 1 129613151 missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129613195 missense probably benign 0.22
IGL02543:Thsd7b APN 1 130165103 missense probably benign 0.03
IGL02740:Thsd7b APN 1 129613127 missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129915615 missense probably benign 0.01
IGL03108:Thsd7b APN 1 130210276 missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130188551 missense probably benign 0.00
IGL03195:Thsd7b APN 1 129628909 missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129760355 missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129596164 missense probably benign 0.17
IGL03399:Thsd7b APN 1 129628885 missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129430964 missense probably benign 0.00
R0277:Thsd7b UTSW 1 130195263 missense probably benign 0.00
R0526:Thsd7b UTSW 1 129951392 missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130188526 missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130188531 missense probably benign 0.00
R0784:Thsd7b UTSW 1 129595359 splice site probably benign
R1158:Thsd7b UTSW 1 130189935 synonymous probably null
R1267:Thsd7b UTSW 1 129628840 intron probably null
R1565:Thsd7b UTSW 1 129596041 missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1728:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1728:Thsd7b UTSW 1 129678183 missense probably benign
R1728:Thsd7b UTSW 1 130116631 missense probably benign
R1729:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1729:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1729:Thsd7b UTSW 1 129678183 missense probably benign
R1729:Thsd7b UTSW 1 130116631 missense probably benign
R1730:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1730:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1730:Thsd7b UTSW 1 129678183 missense probably benign
R1730:Thsd7b UTSW 1 130116631 missense probably benign
R1739:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1739:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1739:Thsd7b UTSW 1 129678183 missense probably benign
R1739:Thsd7b UTSW 1 130116631 missense probably benign
R1762:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1762:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1762:Thsd7b UTSW 1 129678183 missense probably benign
R1762:Thsd7b UTSW 1 130103076 missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 130116631 missense probably benign
R1783:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1783:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1783:Thsd7b UTSW 1 129678183 missense probably benign
R1783:Thsd7b UTSW 1 130116631 missense probably benign
R1784:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1784:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1784:Thsd7b UTSW 1 129678183 missense probably benign
R1784:Thsd7b UTSW 1 130116631 missense probably benign
R1785:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1785:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1785:Thsd7b UTSW 1 129678183 missense probably benign
R1785:Thsd7b UTSW 1 130116631 missense probably benign
R1812:Thsd7b UTSW 1 129758610 missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129613256 missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129678109 missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129758451 nonsense probably null
R2199:Thsd7b UTSW 1 130218158 missense probably benign 0.04
R2483:Thsd7b UTSW 1 130103072 missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130189850 splice site probably benign
R2935:Thsd7b UTSW 1 129678087 missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 130049862 missense probably benign 0.23
R3236:Thsd7b UTSW 1 130218118 nonsense probably null
R3745:Thsd7b UTSW 1 129678241 missense probably benign 0.04
R3877:Thsd7b UTSW 1 130190182 missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129595370 missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4112:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4255:Thsd7b UTSW 1 129760287 missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129430915 missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 130049909 intron probably benign
R4732:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130210264 missense probably benign 0.01
R4805:Thsd7b UTSW 1 130188539 missense probably benign 0.04
R4840:Thsd7b UTSW 1 129595844 missense probably benign 0.00
R4879:Thsd7b UTSW 1 130188499 missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129678145 missense probably benign 0.00
R4972:Thsd7b UTSW 1 130188572 missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129678243 nonsense probably null
R5422:Thsd7b UTSW 1 129921334 missense probably benign 0.41
R5495:Thsd7b UTSW 1 129595833 missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129595841 missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130162936 critical splice donor site probably null
R5638:Thsd7b UTSW 1 129595533 missense probably benign 0.00
R5640:Thsd7b UTSW 1 130116671 nonsense probably null
R5655:Thsd7b UTSW 1 129628934 synonymous probably null
R5711:Thsd7b UTSW 1 129760402 missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129678084 missense probably benign 0.00
R5888:Thsd7b UTSW 1 130210320 nonsense probably null
R5932:Thsd7b UTSW 1 129430838 missense probably benign
R6243:Thsd7b UTSW 1 130162862 missense probably benign 0.21
R6258:Thsd7b UTSW 1 129667918 missense probably benign
R6260:Thsd7b UTSW 1 129667918 missense probably benign
R6399:Thsd7b UTSW 1 129816648 missense probably benign 0.13
R6437:Thsd7b UTSW 1 129816682 missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130159714 splice site probably null
R6785:Thsd7b UTSW 1 129430907 missense probably damaging 0.99
X0027:Thsd7b UTSW 1 129596072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCACAGCCTCATTGCTGTAACTAC -3'
(R):5'- CAACTTTCTTGGTTTGGGCACTGC -3'

Sequencing Primer
(F):5'- GCCTCATTGCTGTAACTACAGTTTC -3'
(R):5'- CTTCAGAGATCATGGCCTTGATG -3'
Posted On2014-02-18