Incidental Mutation 'R1375:Gm765'
ID157465
Institutional Source Beutler Lab
Gene Symbol Gm765
Ensembl Gene ENSMUSG00000090667
Gene Namepredicted gene 765
SynonymsLOC330390
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1375 (G1)
Quality Score213
Status Validated
Chromosome6
Chromosomal Location98235708-98342754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98238299 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 121 (C121Y)
Ref Sequence ENSEMBL: ENSMUSP00000127120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164491
AA Change: C121Y

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127120
Gene: ENSMUSG00000090667
AA Change: C121Y

DomainStartEndE-ValueType
Pfam:MDFI 13 189 1.8e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205146
Meta Mutation Damage Score 0.0432 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Gm765
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02184:Gm765 APN 6 98248098 missense possibly damaging 0.81
IGL02217:Gm765 APN 6 98248072 missense possibly damaging 0.93
R0508:Gm765 UTSW 6 98238044 utr 3 prime probably benign
R1694:Gm765 UTSW 6 98238139 missense probably damaging 0.98
R1944:Gm765 UTSW 6 98248190 missense probably benign 0.01
R4906:Gm765 UTSW 6 98238119 missense probably damaging 1.00
R5472:Gm765 UTSW 6 98238276 missense probably damaging 1.00
R5680:Gm765 UTSW 6 98248226 missense probably damaging 0.99
R6285:Gm765 UTSW 6 98238173 missense probably damaging 1.00
R6692:Gm765 UTSW 6 98248208 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTAAGGACCGCCTGAGTGCTAATC -3'
(R):5'- GCGCCACCCGAACAGTTTTATG -3'

Sequencing Primer
(F):5'- TCGGTAACAGATTTCTGATATCTCC -3'
(R):5'- CACCCGAACAGTTTTATGTAACATAC -3'
Posted On2014-02-18