Incidental Mutation 'R1375:Ggn'
ID157467
Institutional Source Beutler Lab
Gene Symbol Ggn
Ensembl Gene ENSMUSG00000031493
Gene Namegametogenetin
Synonyms
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1375 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29170210-29173976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29171941 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000146750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033886] [ENSMUST00000048923] [ENSMUST00000059642] [ENSMUST00000098609] [ENSMUST00000182328] [ENSMUST00000186182] [ENSMUST00000208288] [ENSMUST00000208330] [ENSMUST00000209019] [ENSMUST00000209034]
Predicted Effect probably benign
Transcript: ENSMUST00000033886
SMART Domains Protein: ENSMUSP00000033886
Gene: ENSMUSG00000031493

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048923
SMART Domains Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239

DomainStartEndE-ValueType
Pfam:WH1 1 110 1.6e-13 PFAM
low complexity region 120 130 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Pfam:Sprouty 292 400 7.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059642
SMART Domains Protein: ENSMUSP00000051657
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
Pfam:CSN8_PSD8_EIF3K 189 330 1.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098609
AA Change: S285P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096209
Gene: ENSMUSG00000031493
AA Change: S285P

DomainStartEndE-ValueType
Pfam:GGN 38 342 2.1e-158 PFAM
Pfam:GGN 340 709 1.5e-165 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130390
Predicted Effect probably benign
Transcript: ENSMUST00000182328
SMART Domains Protein: ENSMUSP00000138613
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:SAC3_GANP 49 232 1.2e-37 PFAM
Pfam:PCI_Csn8 125 266 4.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186182
SMART Domains Protein: ENSMUSP00000139514
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
Pfam:SAC3_GANP 113 296 1.3e-37 PFAM
Pfam:PCI_Csn8 189 330 2.3e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207778
Predicted Effect probably benign
Transcript: ENSMUST00000208288
Predicted Effect probably damaging
Transcript: ENSMUST00000208330
AA Change: S262P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208659
Predicted Effect probably damaging
Transcript: ENSMUST00000209019
AA Change: S249P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000209034
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a germ cell-specific gene that encodes proteins that interact with POG (proliferation of germ cells). Alternatively spliced transcript variants of a similar mouse gene encode at least three different proteins, namely gametogenetin protein 1a, gametogenetin protein 2, and gametogenetin protein 3, which show a perinuclear, cytoplasmic, and nucleolar localization, respectively. These proteins regulate the localization of POG and may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for this allele exhibit impaired double-strand break repair in spermatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Ggn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0110:Ggn UTSW 7 29171296 missense probably damaging 1.00
R0302:Ggn UTSW 7 29171240 unclassified probably null
R0317:Ggn UTSW 7 29171090 start codon destroyed probably null
R0376:Ggn UTSW 7 29173022 missense possibly damaging 0.51
R0469:Ggn UTSW 7 29171296 missense probably damaging 1.00
R0581:Ggn UTSW 7 29172304 missense probably benign 0.40
R1956:Ggn UTSW 7 29171916 missense probably damaging 0.99
R2012:Ggn UTSW 7 29173763 unclassified probably null
R4436:Ggn UTSW 7 29171551 missense probably damaging 0.98
R4444:Ggn UTSW 7 29172160 missense probably benign 0.06
R4977:Ggn UTSW 7 29172196 missense probably damaging 1.00
R5762:Ggn UTSW 7 29172352 missense probably damaging 0.98
R5822:Ggn UTSW 7 29172556 missense probably damaging 0.97
R6180:Ggn UTSW 7 29173049 missense probably damaging 0.98
R6294:Ggn UTSW 7 29173848 missense possibly damaging 0.92
R6667:Ggn UTSW 7 29172668 missense possibly damaging 0.71
R6963:Ggn UTSW 7 29171582 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCACCATCAACTTGCGATCCG -3'
(R):5'- AATGCCGTTCAGTGCCATCAGGAG -3'

Sequencing Primer
(F):5'- GCAGAATCACTCTGGCCTC -3'
(R):5'- TTTCCTGAGCTGCACGAG -3'
Posted On2014-02-18