Incidental Mutation 'R1375:Olfr910'
ID157474
Institutional Source Beutler Lab
Gene Symbol Olfr910
Ensembl Gene ENSMUSG00000060114
Gene Nameolfactory receptor 910
SynonymsMOR165-3, GA_x6K02T2PVTD-32239063-32239995
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1375 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38537849-38540820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38539534 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 213 (V213D)
Ref Sequence ENSEMBL: ENSMUSP00000149263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073214
AA Change: V213D

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072947
Gene: ENSMUSG00000057444
AA Change: V213D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-49 PFAM
Pfam:7tm_1 41 290 4.2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215122
AA Change: V213D

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Olfr910
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02740:Olfr910 APN 9 38538930 missense probably damaging 1.00
R0096:Olfr910 UTSW 9 38539536 missense probably damaging 0.96
R0550:Olfr910 UTSW 9 38539380 missense probably damaging 0.97
R1698:Olfr910 UTSW 9 38539256 nonsense probably null
R2067:Olfr910 UTSW 9 38539280 missense probably benign 0.09
R2111:Olfr910 UTSW 9 38539280 missense probably benign 0.09
R2519:Olfr910 UTSW 9 38538985 missense probably damaging 0.99
R4742:Olfr910 UTSW 9 38539656 missense probably damaging 1.00
R4782:Olfr910 UTSW 9 38539075 missense probably damaging 1.00
R6491:Olfr910 UTSW 9 38647455 missense probably damaging 1.00
Z1088:Olfr910 UTSW 9 38539149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGGATGTATGACTCAACTCTACTTC -3'
(R):5'- GATTAAAGGGTTCATCATGGGGACCAC -3'

Sequencing Primer
(F):5'- TATGTCCTGACAGCAATGGC -3'
(R):5'- TTCATCATGGGGACCACAATGG -3'
Posted On2014-02-18