Incidental Mutation 'R1375:Rbpms2'
ID157475
Institutional Source Beutler Lab
Gene Symbol Rbpms2
Ensembl Gene ENSMUSG00000032387
Gene NameRNA binding protein with multiple splicing 2
Synonyms2400008B06Rik
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1375 (G1)
Quality Score217
Status Validated
Chromosome9
Chromosomal Location65629648-65660528 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC at 65651666 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055844] [ENSMUST00000169003] [ENSMUST00000216342] [ENSMUST00000216382]
Predicted Effect probably benign
Transcript: ENSMUST00000055844
SMART Domains Protein: ENSMUSP00000057600
Gene: ENSMUSG00000032387

DomainStartEndE-ValueType
RRM 26 98 7.84e-8 SMART
low complexity region 172 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169003
SMART Domains Protein: ENSMUSP00000131076
Gene: ENSMUSG00000032387

DomainStartEndE-ValueType
RRM 26 98 7.84e-8 SMART
low complexity region 135 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213927
Predicted Effect probably benign
Transcript: ENSMUST00000216342
Predicted Effect probably benign
Transcript: ENSMUST00000216382
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RNA recognition motif (RRM)-containing protein family and is involved in the development and dedifferentiation of digestive smooth muscle cells. The encoded protein functions as a homodimer and indirectly inhibits the bone morphogenetic protein pathway. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Rbpms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0018:Rbpms2 UTSW 9 65651078 missense probably damaging 1.00
R0018:Rbpms2 UTSW 9 65651078 missense probably damaging 1.00
R0567:Rbpms2 UTSW 9 65651666 unclassified probably benign
R0568:Rbpms2 UTSW 9 65651666 unclassified probably benign
R0570:Rbpms2 UTSW 9 65659194 nonsense probably null
R0727:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1374:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1377:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1390:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1412:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1662:Rbpms2 UTSW 9 65651042 missense probably benign 0.05
R1710:Rbpms2 UTSW 9 65659212 splice site probably benign
R1714:Rbpms2 UTSW 9 65651665 unclassified probably benign
R1714:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1715:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1838:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1838:Rbpms2 UTSW 9 65651680 unclassified probably benign
R1839:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1882:Rbpms2 UTSW 9 65651666 unclassified probably benign
R2088:Rbpms2 UTSW 9 65630839 missense probably damaging 0.99
R2118:Rbpms2 UTSW 9 65650947 missense probably damaging 1.00
R2237:Rbpms2 UTSW 9 65651611 nonsense probably null
R4633:Rbpms2 UTSW 9 65651636 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTATTCATCAAGCCAAGCAAGTTCACG -3'
(R):5'- TGAGAAAAGACAACAATTCTGTTGCTGC -3'

Sequencing Primer
(F):5'- CCTGGTCTTGAGGAAGGGTAAC -3'
(R):5'- CACTCAAAATGGCTTACCTGAGC -3'
Posted On2014-02-18