Incidental Mutation 'R1375:Ccng1'
ID157480
Institutional Source Beutler Lab
Gene Symbol Ccng1
Ensembl Gene ENSMUSG00000020326
Gene Namecyclin G1
Synonymscyclin G
MMRRC Submission 039439-MU
Accession Numbers

Genbank: NM_009831

Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R1375 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location40748552-40755311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40752114 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 169 (P169S)
Ref Sequence ENSEMBL: ENSMUSP00000020576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020576]
Predicted Effect probably benign
Transcript: ENSMUST00000020576
AA Change: P169S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020576
Gene: ENSMUSG00000020326
AA Change: P169S

DomainStartEndE-ValueType
CYCLIN 56 142 3.63e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151359
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The protein encoded by this gene is a member of the cyclin family and contains the cyclin box. The encoded protein lacks the protein destabilizing (PEST) sequence that is present in other family members. Transcriptional activation of this gene can be induced by tumor protein p53. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Depending on the allele, homozygous mutants exhibit increased cellular sensitivity to gamma-irradiation or decreased incidence of induced hepatic tumors. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Ccng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Ccng1 APN 11 40754058 missense probably benign 0.00
IGL01875:Ccng1 APN 11 40752356 missense probably benign 0.09
IGL02986:Ccng1 APN 11 40750863 utr 3 prime probably benign
G5030:Ccng1 UTSW 11 40753802 splice site probably benign
R1377:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R1715:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R3620:Ccng1 UTSW 11 40752165 missense probably benign 0.01
R3857:Ccng1 UTSW 11 40753833 missense probably damaging 0.99
R3858:Ccng1 UTSW 11 40753833 missense probably damaging 0.99
R5082:Ccng1 UTSW 11 40752188 missense possibly damaging 0.77
R5172:Ccng1 UTSW 11 40751286 missense probably benign
R5521:Ccng1 UTSW 11 40752266 missense possibly damaging 0.87
T0975:Ccng1 UTSW 11 40754044 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTGGCAGGCATCTTTTCACTTC -3'
(R):5'- ACCCAAAGCCACTGGTTTCAAGTAG -3'

Sequencing Primer
(F):5'- CACTTCTGTTAGGCAGCAAAG -3'
(R):5'- GTGTCCTACTGAAGCACTGTAAAG -3'
Posted On2014-02-18