Incidental Mutation 'R1375:Gm17541'
ID157484
Institutional Source Beutler Lab
Gene Symbol Gm17541
Ensembl Gene ENSMUSG00000091732
Gene Namepredicted gene, 17541
Synonyms
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1375 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4689405-4689917 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 4689825 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect probably benign
Transcript: ENSMUST00000062580
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080062
SMART Domains Protein: ENSMUSP00000129198
Gene: ENSMUSG00000091732

DomainStartEndE-ValueType
Pfam:Ribosomal_L18ae 4 127 2.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect probably benign
Transcript: ENSMUST00000220311
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Il17b T C 18: 61,690,254 V53A probably benign Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Gm17541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Gm17541 APN 12 4689868 intron probably benign
IGL02006:Gm17541 APN 12 4689619 intron probably benign
IGL02525:Gm17541 APN 12 4689907 intron probably benign
R0266:Gm17541 UTSW 12 4689487 intron probably benign
R0501:Gm17541 UTSW 12 4689730 intron probably benign
R4283:Gm17541 UTSW 12 4689656 intron probably benign
R5256:Gm17541 UTSW 12 4689672 intron probably benign
R5512:Gm17541 UTSW 12 4689452 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAGTCATGGAACTGCTTGACAG -3'
(R):5'- TCCCAAAGTATCTTCATGGGATGTTGC -3'

Sequencing Primer
(F):5'- TAGCACTGTGAGACTGCAC -3'
(R):5'- TTGCAGCAAGCACCTGAATAG -3'
Posted On2014-02-18