Incidental Mutation 'R1375:Il17b'
ID157489
Institutional Source Beutler Lab
Gene Symbol Il17b
Ensembl Gene ENSMUSG00000024578
Gene Nameinterleukin 17B
SynonymsZcyto7, 1700006N07Rik, 1110006O16Rik
MMRRC Submission 039439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R1375 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location61687935-61692537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61690254 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 53 (V53A)
Ref Sequence ENSEMBL: ENSMUSP00000025471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025471]
Predicted Effect probably benign
Transcript: ENSMUST00000025471
AA Change: V53A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025471
Gene: ENSMUSG00000024578
AA Change: V53A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:IL17 96 179 1.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191654
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.8%
  • 20x: 89.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a T cell-derived cytokine that shares sequence similarity with IL17. This cytokine was reported to stimulate the release of TNF alpha (TNF) and IL1 beta (IL1B) from a monocytic cell line. Immunohistochemical analysis of several nerve tissues indicated that this cytokine is primarily localized to neuronal cell bodies. Alternative splicing results in multiple splice variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased susceptibility to DDS-induced colitis and Citrobacter rodentium infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,352,216 V1268A possibly damaging Het
Ccng1 G A 11: 40,752,114 P169S probably benign Het
Cep85l A T 10: 53,349,258 D78E probably damaging Het
Csmd1 C A 8: 16,463,081 probably null Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Defb15 T C 8: 21,930,055 N19D possibly damaging Het
Dnah8 G A 17: 30,737,295 G2083D probably damaging Het
Fam208b A G 13: 3,576,029 V1307A probably benign Het
Ggn T C 7: 29,171,941 S249P probably damaging Het
Gm17541 A T 12: 4,689,825 probably benign Het
Gm765 C T 6: 98,238,299 C121Y possibly damaging Het
Gnptab T A 10: 88,432,573 L514Q probably damaging Het
Heg1 C A 16: 33,726,876 H678N possibly damaging Het
Heg1 T C 16: 33,727,309 I846T possibly damaging Het
Hydin G A 8: 110,506,222 probably null Het
Inpp5f T A 7: 128,664,029 L166* probably null Het
Myh9 A T 15: 77,769,368 probably null Het
Nsrp1 A G 11: 77,050,717 probably benign Het
Nup205 T C 6: 35,200,071 probably benign Het
Olfr1133 T A 2: 87,645,737 N129Y probably damaging Het
Olfr711 A G 7: 106,972,098 L82P probably damaging Het
Olfr801 A T 10: 129,670,372 L12Q probably null Het
Olfr910 T A 9: 38,539,534 V213D possibly damaging Het
Olr1 T C 6: 129,507,076 N11S possibly damaging Het
Pipox C A 11: 77,881,210 E363* probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rpp30 T C 19: 36,101,273 probably null Het
Sept1 T C 7: 127,218,161 D25G probably damaging Het
Stk17b T C 1: 53,765,947 N152D possibly damaging Het
Thsd7b A T 1: 130,159,686 N1180I probably damaging Het
Other mutations in Il17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0045:Il17b UTSW 18 61690244 missense probably damaging 0.99
R0100:Il17b UTSW 18 61690271 missense probably benign 0.09
R0100:Il17b UTSW 18 61690271 missense probably benign 0.09
R1468:Il17b UTSW 18 61690412 splice site probably null
R1468:Il17b UTSW 18 61690412 splice site probably null
R1517:Il17b UTSW 18 61690245 missense probably damaging 0.98
R2157:Il17b UTSW 18 61690368 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGAAAGACTTCTCACCTCCCTCAC -3'
(R):5'- AAAGTACCTTTAGAAGCACGCCTGG -3'

Sequencing Primer
(F):5'- CTATGCTTTGGCCCAGAGATG -3'
(R):5'- cagaactaatcaaccaacccaac -3'
Posted On2014-02-18