Incidental Mutation 'R1316:Olfr52'
ID157536
Institutional Source Beutler Lab
Gene Symbol Olfr52
Ensembl Gene ENSMUSG00000075199
Gene Nameolfactory receptor 52
SynonymsIE6, MOR185-6, GA_x6K02T2Q125-47650922-47649963
MMRRC Submission 039382-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R1316 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86179412-86185683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86181365 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 249 (S249G)
Ref Sequence ENSEMBL: ENSMUSP00000097489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099905] [ENSMUST00000215138] [ENSMUST00000215171]
Predicted Effect probably benign
Transcript: ENSMUST00000099905
AA Change: S249G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097489
Gene: ENSMUSG00000075199
AA Change: S249G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5e-56 PFAM
Pfam:7tm_1 41 290 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215138
AA Change: S249G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000215171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215739
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,670 V957A probably benign Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cmpk1 A G 4: 114,971,290 probably benign Het
Col11a1 G A 3: 114,138,970 probably null Het
Ears2 T C 7: 122,046,682 T337A probably benign Het
Erbin T C 13: 103,841,234 K605R possibly damaging Het
Irs3 T C 5: 137,644,441 E245G probably damaging Het
Limch1 T C 5: 66,999,243 I223T probably damaging Het
Lrp1b T C 2: 40,702,804 T3768A probably benign Het
Notch4 G A 17: 34,567,470 D195N probably damaging Het
Olfr1463 T C 19: 13,234,439 F63S probably damaging Het
Olfr843 T A 9: 19,248,739 Q220L probably benign Het
Olfr875 T C 9: 37,772,743 F28S possibly damaging Het
Podxl2 A G 6: 88,849,217 L369P probably benign Het
Rnf149 A G 1: 39,565,320 *45Q probably null Het
Slc4a11 T A 2: 130,686,151 E528V probably benign Het
Slc9a1 A G 4: 133,422,247 R795G possibly damaging Het
Slco6d1 A T 1: 98,466,793 M401L probably benign Het
Tiparp T G 3: 65,553,351 F587C probably damaging Het
Vmn2r120 T C 17: 57,525,939 Q80R probably benign Het
Other mutations in Olfr52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Olfr52 APN 2 86181595 unclassified probably null
R0422:Olfr52 UTSW 2 86181222 missense probably benign 0.00
R0688:Olfr52 UTSW 2 86181605 unclassified probably null
R0976:Olfr52 UTSW 2 86181808 missense probably damaging 0.99
R1240:Olfr52 UTSW 2 86182109 start codon destroyed possibly damaging 0.94
R1865:Olfr52 UTSW 2 86181538 missense probably damaging 1.00
R2188:Olfr52 UTSW 2 86181436 missense probably damaging 1.00
R4072:Olfr52 UTSW 2 86181647 missense probably benign 0.02
R4222:Olfr52 UTSW 2 86181997 missense probably damaging 0.99
R5096:Olfr52 UTSW 2 86181932 missense probably damaging 1.00
R5103:Olfr52 UTSW 2 86181616 missense probably benign 0.41
R5934:Olfr52 UTSW 2 86182102 missense probably benign 0.00
R6168:Olfr52 UTSW 2 86181965 missense probably damaging 0.99
R6601:Olfr52 UTSW 2 86181965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACATCCTTGTTCCTGAGGCTGTA -3'
(R):5'- GGTCACAATGTCTCCTGGAATCTGC -3'

Sequencing Primer
(F):5'- TTCCTGAGGCTGTAGATCAAAG -3'
(R):5'- TCAGGCTAACTTGCTCAGATAC -3'
Posted On2014-02-18