Incidental Mutation 'R1317:Abi3bp'
ID157582
Institutional Source Beutler Lab
Gene Symbol Abi3bp
Ensembl Gene ENSMUSG00000035258
Gene NameABI gene family, member 3 (NESH) binding protein
SynonymsD930038M13Rik, eratin, TARSH, 5033411B22Rik
MMRRC Submission 039383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1317 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location56477878-56690135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56668309 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1268 (H1268Y)
Ref Sequence ENSEMBL: ENSMUSP00000156096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]
Predicted Effect probably benign
Transcript: ENSMUST00000048471
AA Change: H810Y

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258
AA Change: H810Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 734 747 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
FN3 941 1024 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096012
AA Change: H710Y

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258
AA Change: H710Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 651 664 N/A INTRINSIC
FN3 841 924 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096013
AA Change: H746Y

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258
AA Change: H746Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 433 446 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
FN3 877 960 6.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171000
AA Change: H540Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258
AA Change: H540Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 114 203 3.08e-2 SMART
low complexity region 464 477 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
FN3 671 754 6.29e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000231781
AA Change: H1268Y

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000231832
AA Change: H515Y

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect unknown
Transcript: ENSMUST00000231870
AA Change: H730Y
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn A G 17: 13,846,273 T576A probably benign Het
Bcl6 G T 16: 23,977,542 A45D probably damaging Het
Ccdc7b A T 8: 129,136,646 H223L probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cryba2 G T 1: 74,890,676 probably null Het
Depdc1a T C 3: 159,523,287 C559R probably damaging Het
Fam20a A T 11: 109,677,838 N287K probably damaging Het
Gm5519 T C 19: 33,824,991 Y145H possibly damaging Het
Gm9602 T A 14: 4,776,499 I28N probably damaging Het
Gmeb1 G A 4: 132,234,887 Q154* probably null Het
Gpr156 T C 16: 37,987,567 L192P probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Ifi209 A G 1: 173,637,463 D53G possibly damaging Het
Irf6 G A 1: 193,169,301 R400H probably damaging Het
Jag2 T A 12: 112,914,501 M537L probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mt1 T C 8: 94,180,153 probably benign Het
Myo15b C A 11: 115,883,634 P2024Q probably null Het
Nphs1 C T 7: 30,481,831 probably benign Het
Rbm27 G A 18: 42,324,051 probably benign Het
Robo2 A G 16: 74,035,024 V256A probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Scg3 G A 9: 75,669,340 T251M probably damaging Het
Slc25a23 T C 17: 57,053,888 K179E possibly damaging Het
Smad5 T C 13: 56,736,071 probably benign Het
Tom1 T C 8: 75,051,551 V87A probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Tspan32 A G 7: 143,017,591 M159V probably benign Het
Tubb1 A G 2: 174,456,896 S124G probably benign Het
Zbtb1 A G 12: 76,386,799 S520G probably benign Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Other mutations in Abi3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Abi3bp APN 16 56602805 missense probably null 0.99
IGL01580:Abi3bp APN 16 56675210 missense probably damaging 1.00
IGL01633:Abi3bp APN 16 56677800 missense probably damaging 1.00
IGL01783:Abi3bp APN 16 56532969 critical splice donor site probably null
IGL01866:Abi3bp APN 16 56671973 missense probably benign 0.19
IGL02022:Abi3bp APN 16 56592636 missense probably damaging 1.00
IGL02086:Abi3bp APN 16 56642567 splice site probably benign
IGL02122:Abi3bp APN 16 56687128 splice site probably benign
IGL02155:Abi3bp APN 16 56587964 missense probably damaging 0.99
IGL02351:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02358:Abi3bp APN 16 56654055 missense possibly damaging 0.91
IGL02418:Abi3bp APN 16 56604116 splice site probably benign
IGL02559:Abi3bp APN 16 56687070 nonsense probably null
IGL02617:Abi3bp APN 16 56574444 nonsense probably null
IGL02810:Abi3bp APN 16 56677775 missense probably damaging 1.00
IGL03057:Abi3bp APN 16 56668391 missense possibly damaging 0.95
IGL03174:Abi3bp APN 16 56614747 missense possibly damaging 0.64
R0389:Abi3bp UTSW 16 56671307 missense possibly damaging 0.79
R0485:Abi3bp UTSW 16 56604012 intron probably null
R0557:Abi3bp UTSW 16 56668387 missense probably damaging 0.97
R0616:Abi3bp UTSW 16 56654070 missense probably damaging 0.99
R0685:Abi3bp UTSW 16 56532953 missense possibly damaging 0.90
R0783:Abi3bp UTSW 16 56595238 critical splice acceptor site probably null
R0828:Abi3bp UTSW 16 56677830 missense probably damaging 1.00
R0841:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1078:Abi3bp UTSW 16 56654081 critical splice donor site probably null
R1101:Abi3bp UTSW 16 56606158 missense probably damaging 1.00
R1116:Abi3bp UTSW 16 56686429 splice site probably benign
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1145:Abi3bp UTSW 16 56668276 missense possibly damaging 0.95
R1384:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1460:Abi3bp UTSW 16 56562417 missense probably damaging 0.99
R1730:Abi3bp UTSW 16 56668279 missense possibly damaging 0.62
R1761:Abi3bp UTSW 16 56668309 missense possibly damaging 0.79
R1830:Abi3bp UTSW 16 56587985 missense probably damaging 1.00
R1873:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1875:Abi3bp UTSW 16 56574499 missense probably damaging 1.00
R1996:Abi3bp UTSW 16 56671357 missense possibly damaging 0.61
R2018:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2019:Abi3bp UTSW 16 56677796 missense probably damaging 1.00
R2035:Abi3bp UTSW 16 56660218 missense probably benign 0.21
R2118:Abi3bp UTSW 16 56477864 unclassified probably benign
R2202:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R2202:Abi3bp UTSW 16 56650725 nonsense probably null
R2203:Abi3bp UTSW 16 56613203 missense probably benign 0.06
R3030:Abi3bp UTSW 16 56657319 missense possibly damaging 0.79
R3952:Abi3bp UTSW 16 56604038 missense possibly damaging 0.88
R4176:Abi3bp UTSW 16 56652200 missense probably damaging 0.96
R4296:Abi3bp UTSW 16 56668310 missense probably benign 0.05
R4301:Abi3bp UTSW 16 56556903 missense probably damaging 1.00
R4354:Abi3bp UTSW 16 56532951 missense probably benign 0.05
R4417:Abi3bp UTSW 16 56654035 missense probably damaging 1.00
R4716:Abi3bp UTSW 16 56650725 nonsense probably null
R4808:Abi3bp UTSW 16 56594516 missense probably damaging 0.96
R4814:Abi3bp UTSW 16 56650753 missense probably benign 0.06
R5016:Abi3bp UTSW 16 56671268 missense probably damaging 0.97
R5290:Abi3bp UTSW 16 56642475 splice site probably null
R5891:Abi3bp UTSW 16 56606133 missense probably damaging 1.00
R5897:Abi3bp UTSW 16 56604669 missense possibly damaging 0.53
R6146:Abi3bp UTSW 16 56671265 missense probably damaging 0.99
R6267:Abi3bp UTSW 16 56594497 missense probably damaging 0.97
R6905:Abi3bp UTSW 16 56574517 missense probably damaging 1.00
R6908:Abi3bp UTSW 16 56657305 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAACCCTTGTGTGCTTCAACTC -3'
(R):5'- GGCTAACAGCATCCAGTCTTTGTGG -3'

Sequencing Primer
(F):5'- TCTGTTGTATCTCCAGAGGAAAG -3'
(R):5'- GGCCAACACAAGCAAGCATC -3'
Posted On2014-02-18