Incidental Mutation 'R1318:Jph1'
ID 157588
Institutional Source Beutler Lab
Gene Symbol Jph1
Ensembl Gene ENSMUSG00000042686
Gene Name junctophilin 1
Synonyms JP-1, ENSMUSG00000054314, mitsugumin72
MMRRC Submission 039384-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.776) question?
Stock # R1318 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 17034784-17168113 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 17067714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 658 (F658V)
Ref Sequence ENSEMBL: ENSMUSP00000039072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038382]
AlphaFold Q9ET80
Predicted Effect probably damaging
Transcript: ENSMUST00000038382
AA Change: F658V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039072
Gene: ENSMUSG00000042686
AA Change: F658V

DomainStartEndE-ValueType
MORN 12 33 7.31e-1 SMART
MORN 36 56 7.6e1 SMART
MORN 58 79 2.49e-1 SMART
Pfam:MORN 82 99 8.9e-3 PFAM
MORN 104 125 3.72e-4 SMART
MORN 127 148 7.86e-3 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
MORN 279 300 2.07e-2 SMART
MORN 302 323 2.86e-5 SMART
low complexity region 382 400 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
transmembrane domain 637 659 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186024
AA Change: F133V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186604
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to suckle and die shortly after birth. Mutants exhibit deficiencies of triad junctions and contraction in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G T 5: 8,751,621 (GRCm39) V334L probably benign Het
Alms1 T G 6: 85,605,531 (GRCm39) S1925A possibly damaging Het
Cdh15 G C 8: 123,584,234 (GRCm39) E112Q probably damaging Het
Comt G T 16: 18,226,641 (GRCm39) D248E probably damaging Het
Ctnna2 A C 6: 76,859,773 (GRCm39) N874K probably damaging Het
Dnah7b C T 1: 46,138,669 (GRCm39) P237L possibly damaging Het
Galnt4 T G 10: 98,945,772 (GRCm39) V499G probably damaging Het
Gh T C 11: 106,191,923 (GRCm39) T96A probably benign Het
Gng8 T C 7: 16,629,161 (GRCm39) V29A probably damaging Het
Hnrnpu G A 1: 178,157,822 (GRCm39) probably benign Het
Igdcc4 T C 9: 65,040,972 (GRCm39) L1001P probably damaging Het
Kcnj3 A T 2: 55,327,750 (GRCm39) M180L possibly damaging Het
Ldb2 C T 5: 44,692,379 (GRCm39) probably null Het
Mettl2 C A 11: 105,028,597 (GRCm39) Y316* probably null Het
Mug2 G A 6: 122,054,361 (GRCm39) V1047M probably damaging Het
Mxra8 G T 4: 155,925,956 (GRCm39) C140F probably damaging Het
Mylip T C 13: 45,559,401 (GRCm39) I101T probably benign Het
Oasl2 A G 5: 115,039,442 (GRCm39) N210S probably benign Het
Pclo A G 5: 14,729,328 (GRCm39) probably benign Het
Plaat3 T A 19: 7,556,591 (GRCm39) probably null Het
Rims2 G A 15: 39,381,222 (GRCm39) R1051H probably damaging Het
Rnf4 C A 5: 34,508,590 (GRCm39) R151S probably damaging Het
Serpina11 A T 12: 103,952,777 (GRCm39) probably benign Het
Trim30b T A 7: 104,006,542 (GRCm39) T105S possibly damaging Het
Ttn T C 2: 76,706,164 (GRCm39) probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Zranb1 C A 7: 132,568,281 (GRCm39) S313* probably null Het
Other mutations in Jph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Jph1 APN 1 17,161,964 (GRCm39) missense probably damaging 1.00
IGL01382:Jph1 APN 1 17,086,380 (GRCm39) missense probably damaging 1.00
IGL01936:Jph1 APN 1 17,167,608 (GRCm39) missense probably damaging 0.98
IGL02012:Jph1 APN 1 17,167,638 (GRCm39) missense probably benign 0.00
IGL02142:Jph1 APN 1 17,161,884 (GRCm39) missense probably damaging 0.99
IGL02212:Jph1 APN 1 17,161,981 (GRCm39) missense probably damaging 1.00
IGL02317:Jph1 APN 1 17,074,147 (GRCm39) missense probably benign
IGL02450:Jph1 APN 1 17,074,201 (GRCm39) missense possibly damaging 0.77
IGL02707:Jph1 APN 1 17,074,675 (GRCm39) missense probably benign
R0668:Jph1 UTSW 1 17,161,895 (GRCm39) missense probably damaging 1.00
R0893:Jph1 UTSW 1 17,074,507 (GRCm39) nonsense probably null
R1308:Jph1 UTSW 1 17,161,918 (GRCm39) missense probably damaging 1.00
R1495:Jph1 UTSW 1 17,161,876 (GRCm39) missense probably benign
R1712:Jph1 UTSW 1 17,167,456 (GRCm39) missense possibly damaging 0.57
R1916:Jph1 UTSW 1 17,162,279 (GRCm39) missense probably damaging 1.00
R4492:Jph1 UTSW 1 17,067,770 (GRCm39) missense probably damaging 1.00
R4559:Jph1 UTSW 1 17,074,735 (GRCm39) missense probably benign
R4565:Jph1 UTSW 1 17,074,426 (GRCm39) missense possibly damaging 0.91
R4694:Jph1 UTSW 1 17,067,729 (GRCm39) missense probably damaging 0.98
R4700:Jph1 UTSW 1 17,161,928 (GRCm39) missense possibly damaging 0.82
R4906:Jph1 UTSW 1 17,161,835 (GRCm39) missense probably damaging 1.00
R5029:Jph1 UTSW 1 17,161,615 (GRCm39) missense possibly damaging 0.85
R5256:Jph1 UTSW 1 17,161,622 (GRCm39) missense probably benign 0.38
R5316:Jph1 UTSW 1 17,161,750 (GRCm39) missense probably damaging 1.00
R5691:Jph1 UTSW 1 17,074,587 (GRCm39) missense probably benign 0.21
R6209:Jph1 UTSW 1 17,167,810 (GRCm39) missense probably damaging 0.98
R6380:Jph1 UTSW 1 17,162,071 (GRCm39) missense probably damaging 1.00
R6645:Jph1 UTSW 1 17,161,985 (GRCm39) missense probably damaging 1.00
R6829:Jph1 UTSW 1 17,074,647 (GRCm39) missense probably damaging 1.00
R7007:Jph1 UTSW 1 17,074,410 (GRCm39) missense possibly damaging 0.85
R7276:Jph1 UTSW 1 17,162,266 (GRCm39) missense probably damaging 1.00
R7689:Jph1 UTSW 1 17,074,192 (GRCm39) nonsense probably null
R7719:Jph1 UTSW 1 17,162,215 (GRCm39) missense probably damaging 1.00
R7792:Jph1 UTSW 1 17,074,602 (GRCm39) missense probably benign 0.02
R8132:Jph1 UTSW 1 17,086,379 (GRCm39) missense probably damaging 1.00
R8871:Jph1 UTSW 1 17,067,719 (GRCm39) missense possibly damaging 0.83
R9217:Jph1 UTSW 1 17,167,632 (GRCm39) missense probably benign 0.24
R9272:Jph1 UTSW 1 17,161,838 (GRCm39) missense probably damaging 1.00
R9631:Jph1 UTSW 1 17,161,607 (GRCm39) missense probably damaging 0.99
Z1176:Jph1 UTSW 1 17,167,576 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCAAGGCAGAACTGTGGGCTAAC -3'
(R):5'- TGACCTGTCCCAGTGTGAGAGATG -3'

Sequencing Primer
(F):5'- GACTTCACTGATGAGTCGAAAC -3'
(R):5'- gacttcagactcagagtgcc -3'
Posted On 2014-02-18