Incidental Mutation 'R1318:Cdh15'
ID157606
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Namecadherin 15
SynonymsM cadherin, Mcad, Cdh14
MMRRC Submission 039384-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1318 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location122847966-122867397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 122857495 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 112 (E112Q)
Ref Sequence ENSEMBL: ENSMUSP00000034443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000034443
AA Change: E112Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: E112Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G T 5: 8,701,621 V334L probably benign Het
Alms1 T G 6: 85,628,549 S1925A possibly damaging Het
Comt G T 16: 18,407,891 D248E probably damaging Het
Ctnna2 A C 6: 76,882,790 N874K probably damaging Het
Dnah7b C T 1: 46,099,509 P237L possibly damaging Het
Galnt4 T G 10: 99,109,910 V499G probably damaging Het
Gh T C 11: 106,301,097 T96A probably benign Het
Gng8 T C 7: 16,895,236 V29A probably damaging Het
Hnrnpu G A 1: 178,330,257 probably benign Het
Igdcc4 T C 9: 65,133,690 L1001P probably damaging Het
Jph1 A C 1: 16,997,490 F658V probably damaging Het
Kcnj3 A T 2: 55,437,738 M180L possibly damaging Het
Ldb2 C T 5: 44,535,037 probably null Het
Mettl2 C A 11: 105,137,771 Y316* probably null Het
Mug2 G A 6: 122,077,402 V1047M probably damaging Het
Mxra8 G T 4: 155,841,499 C140F probably damaging Het
Mylip T C 13: 45,405,925 I101T probably benign Het
Oasl2 A G 5: 114,901,381 N210S probably benign Het
Pclo A G 5: 14,679,314 probably benign Het
Pla2g16 T A 19: 7,579,226 probably null Het
Rims2 G A 15: 39,517,826 R1051H probably damaging Het
Rnf4 C A 5: 34,351,246 R151S probably damaging Het
Serpina11 A T 12: 103,986,518 probably benign Het
Trim30b T A 7: 104,357,335 T105S possibly damaging Het
Ttn T C 2: 76,875,820 probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zranb1 C A 7: 132,966,552 S313* probably null Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 122865323 intron probably benign
IGL01958:Cdh15 APN 8 122859350 missense probably damaging 1.00
IGL02588:Cdh15 APN 8 122856552 nonsense probably null
IGL02793:Cdh15 APN 8 122860982 missense probably damaging 1.00
IGL02947:Cdh15 APN 8 122865372 missense probably benign 0.00
R0310:Cdh15 UTSW 8 122865436 missense probably damaging 1.00
R0441:Cdh15 UTSW 8 122860966 missense probably damaging 1.00
R0766:Cdh15 UTSW 8 122861449 intron probably benign
R0898:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1023:Cdh15 UTSW 8 122865200 missense probably damaging 0.98
R1054:Cdh15 UTSW 8 122864337 missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R1081:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1101:Cdh15 UTSW 8 122860846 missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1208:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1209:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1210:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1312:Cdh15 UTSW 8 122861449 intron probably benign
R1317:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1393:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1428:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1429:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1695:Cdh15 UTSW 8 122862016 missense probably benign 0.05
R2157:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2170:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2178:Cdh15 UTSW 8 122864976 splice site probably null
R2252:Cdh15 UTSW 8 122857422 missense probably damaging 1.00
R2290:Cdh15 UTSW 8 122859317 missense probably damaging 1.00
R2317:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2330:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2345:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2349:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2353:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2354:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2566:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2567:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2568:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2893:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2894:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2937:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2938:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2990:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2992:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2993:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3029:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3030:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3195:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R3441:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3442:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3608:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3686:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R4119:Cdh15 UTSW 8 122863423 missense probably damaging 1.00
R4120:Cdh15 UTSW 8 122863423 missense probably damaging 1.00
R4477:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4478:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4480:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4580:Cdh15 UTSW 8 122865158 missense probably damaging 0.99
R4583:Cdh15 UTSW 8 122865028 missense probably damaging 0.98
R4619:Cdh15 UTSW 8 122860873 missense probably damaging 1.00
R4694:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R4731:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R5076:Cdh15 UTSW 8 122864348 missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 122862063 missense probably null 1.00
R5375:Cdh15 UTSW 8 122865100 missense probably damaging 1.00
R5498:Cdh15 UTSW 8 122865178 missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 122856587 missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 122864347 missense probably benign 0.01
R6570:Cdh15 UTSW 8 122857391 missense probably damaging 1.00
R6708:Cdh15 UTSW 8 122863555 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CCTCTGTTGGGGTGAAACACGAAG -3'
(R):5'- ACAGTGATGCTCTGCTCTCCAAAAG -3'

Sequencing Primer
(F):5'- CACGAAGGTATTGGGGTGC -3'
(R):5'- ACCTATTCGCGGCCTCAAG -3'
Posted On2014-02-18