Incidental Mutation 'R1321:Nrbp1'
ID157677
Institutional Source Beutler Lab
Gene Symbol Nrbp1
Ensembl Gene ENSMUSG00000029148
Gene Namenuclear receptor binding protein 1
SynonymsB230344L17Rik, Nrbp
MMRRC Submission 039387-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1321 (G1)
Quality Score221
Status Validated
Chromosome5
Chromosomal Location31240864-31251566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31245813 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 210 (I210N)
Ref Sequence ENSEMBL: ENSMUSP00000143872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031034] [ENSMUST00000068997] [ENSMUST00000201259] [ENSMUST00000202505] [ENSMUST00000202576] [ENSMUST00000202842]
Predicted Effect probably damaging
Transcript: ENSMUST00000031034
AA Change: I210N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031034
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 324 5.8e-26 PFAM
Pfam:Pkinase 80 327 1e-26 PFAM
low complexity region 412 436 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068997
SMART Domains Protein: ENSMUSP00000070496
Gene: ENSMUSG00000055424

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
low complexity region 78 101 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078312
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077426
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000139602
AA Change: I194N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141973
AA Change: S309T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201070
Predicted Effect probably benign
Transcript: ENSMUST00000201259
Predicted Effect probably damaging
Transcript: ENSMUST00000202505
AA Change: I125N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144292
Gene: ENSMUSG00000029148
AA Change: I125N

DomainStartEndE-ValueType
STYKc 14 184 1.3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202576
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143872
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202801
Predicted Effect probably benign
Transcript: ENSMUST00000202842
SMART Domains Protein: ENSMUSP00000143899
Gene: ENSMUSG00000029148

DomainStartEndE-ValueType
Pfam:Pkinase 2 88 4.8e-5 PFAM
Pfam:Pkinase_Tyr 3 88 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202982
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,898,544 probably benign Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
C2cd2l A G 9: 44,317,581 probably null Het
Cass4 T A 2: 172,424,652 L205Q probably benign Het
Celsr3 G A 9: 108,835,870 D1834N probably damaging Het
Col12a1 A T 9: 79,617,709 C2723* probably null Het
Cps1 A G 1: 67,143,019 probably benign Het
Dolpp1 A G 2: 30,395,736 I49V possibly damaging Het
Dppa2 A G 16: 48,311,636 E32G possibly damaging Het
Eif2b5 C T 16: 20,504,689 R397* probably null Het
Far2 G T 6: 148,173,536 probably benign Het
Fbxo42 C T 4: 141,167,849 T41I probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Galnt13 G A 2: 55,098,594 R476Q probably damaging Het
Galnt18 A T 7: 111,779,432 V39E probably benign Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21954 C T 3: 55,472,206 probably benign Het
Lct A C 1: 128,300,022 L1245V probably benign Het
Lgr5 T C 10: 115,478,457 T192A probably damaging Het
Mrpl42 C T 10: 95,493,711 V46M probably damaging Het
Mybpc1 C T 10: 88,529,541 V907M possibly damaging Het
Mybpc1 T A 10: 88,570,601 Y127F probably damaging Het
Nov G T 15: 54,749,246 C217F probably damaging Het
Otud4 T C 8: 79,669,950 S613P probably benign Het
P2ry12 T C 3: 59,217,225 E343G possibly damaging Het
Pbrm1 A C 14: 31,067,502 K670T probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Reg3b A G 6: 78,372,953 probably null Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Ssr2 T C 3: 88,576,954 probably benign Het
Syne3 A C 12: 104,975,796 V29G probably benign Het
Ubr4 T C 4: 139,460,123 V3834A possibly damaging Het
Vmn2r112 C T 17: 22,618,519 Q654* probably null Het
Vmn2r14 C T 5: 109,216,251 V600I probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Nrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nrbp1 APN 5 31251059 missense possibly damaging 0.74
IGL00926:Nrbp1 APN 5 31243797 missense probably benign 0.07
ghetto UTSW 5 31245846 critical splice donor site probably null
pudong UTSW 5 31250137 missense probably damaging 1.00
Shanghai UTSW 5 31245813 missense probably damaging 1.00
R0358:Nrbp1 UTSW 5 31244887 missense probably damaging 1.00
R0993:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1139:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1177:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1179:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1180:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1193:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1194:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1196:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1267:Nrbp1 UTSW 5 31250590 missense probably benign 0.00
R1302:Nrbp1 UTSW 5 31249889 missense probably benign 0.00
R1320:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1322:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1324:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1325:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1341:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1388:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1411:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1448:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1697:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1815:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1816:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1950:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1987:Nrbp1 UTSW 5 31245391 missense probably damaging 1.00
R2079:Nrbp1 UTSW 5 31251073 missense probably benign 0.08
R2142:Nrbp1 UTSW 5 31247929 missense possibly damaging 0.95
R4299:Nrbp1 UTSW 5 31250599 critical splice donor site probably null
R5115:Nrbp1 UTSW 5 31243715 nonsense probably null
R5168:Nrbp1 UTSW 5 31250137 missense probably damaging 1.00
R5640:Nrbp1 UTSW 5 31249585 missense possibly damaging 0.96
R6765:Nrbp1 UTSW 5 31245846 critical splice donor site probably null
R7022:Nrbp1 UTSW 5 31244481 missense probably damaging 1.00
R7044:Nrbp1 UTSW 5 31249946 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAGAGCTGGCCCTTACTCTTCTTAAC -3'
(R):5'- TTTGGCCCGAAGGACTAGAGTCAGAC -3'

Sequencing Primer
(F):5'- ACCCTTGGGTTCCCCCTG -3'
(R):5'- GAAGGACTAGAGTCAGACCTCATATC -3'
Posted On2014-02-18