Incidental Mutation 'R1321:Reg3b'
ID157680
Institutional Source Beutler Lab
Gene Symbol Reg3b
Ensembl Gene ENSMUSG00000071356
Gene Nameregenerating islet-derived 3 beta
SynonymsPap, PAP1, REG-III, RegIII (beta)
MMRRC Submission 039387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1321 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location78370657-78373466 bp(+) (GRCm38)
Type of Mutationunclassified (55 bp from exon)
DNA Base Change (assembly) A to G at 78372953 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089667] [ENSMUST00000096904] [ENSMUST00000167492] [ENSMUST00000203266] [ENSMUST00000204873] [ENSMUST00000205240]
Predicted Effect probably benign
Transcript: ENSMUST00000089667
SMART Domains Protein: ENSMUSP00000087096
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 172 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096904
SMART Domains Protein: ENSMUSP00000094667
Gene: ENSMUSG00000071356

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 172 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167492
SMART Domains Protein: ENSMUSP00000132220
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 126 1.66e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203266
SMART Domains Protein: ENSMUSP00000145528
Gene: ENSMUSG00000071356

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 143 5e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204760
Predicted Effect probably null
Transcript: ENSMUST00000204873
SMART Domains Protein: ENSMUSP00000145280
Gene: ENSMUSG00000071356

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 140 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205240
SMART Domains Protein: ENSMUSP00000144715
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 126 1.66e-1 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It has similarity to the C-type lectin superfamily. The enhanced expression of this gene is observed during pancreatic inflammation and liver carcinogenesis. The mature protein also functions as an antimicrobial protein with antibacterial activity. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Nov 2014]
PHENOTYPE: Male homozygous mice exhibit impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,898,544 probably benign Het
Aco2 C T 15: 81,895,193 S33L probably damaging Het
C2cd2l A G 9: 44,317,581 probably null Het
Cass4 T A 2: 172,424,652 L205Q probably benign Het
Celsr3 G A 9: 108,835,870 D1834N probably damaging Het
Col12a1 A T 9: 79,617,709 C2723* probably null Het
Cps1 A G 1: 67,143,019 probably benign Het
Dolpp1 A G 2: 30,395,736 I49V possibly damaging Het
Dppa2 A G 16: 48,311,636 E32G possibly damaging Het
Eif2b5 C T 16: 20,504,689 R397* probably null Het
Far2 G T 6: 148,173,536 probably benign Het
Fbxo42 C T 4: 141,167,849 T41I probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Galnt13 G A 2: 55,098,594 R476Q probably damaging Het
Galnt18 A T 7: 111,779,432 V39E probably benign Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21954 C T 3: 55,472,206 probably benign Het
Lct A C 1: 128,300,022 L1245V probably benign Het
Lgr5 T C 10: 115,478,457 T192A probably damaging Het
Mrpl42 C T 10: 95,493,711 V46M probably damaging Het
Mybpc1 C T 10: 88,529,541 V907M possibly damaging Het
Mybpc1 T A 10: 88,570,601 Y127F probably damaging Het
Nov G T 15: 54,749,246 C217F probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Otud4 T C 8: 79,669,950 S613P probably benign Het
P2ry12 T C 3: 59,217,225 E343G possibly damaging Het
Pbrm1 A C 14: 31,067,502 K670T probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Ssr2 T C 3: 88,576,954 probably benign Het
Syne3 A C 12: 104,975,796 V29G probably benign Het
Ubr4 T C 4: 139,460,123 V3834A possibly damaging Het
Vmn2r112 C T 17: 22,618,519 Q654* probably null Het
Vmn2r14 C T 5: 109,216,251 V600I probably benign Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Other mutations in Reg3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03143:Reg3b APN 6 78372200 nonsense probably null
R0017:Reg3b UTSW 6 78372861 missense possibly damaging 0.48
R0017:Reg3b UTSW 6 78372861 missense possibly damaging 0.48
R0413:Reg3b UTSW 6 78371841 missense probably damaging 1.00
R1794:Reg3b UTSW 6 78372214 unclassified probably null
R1960:Reg3b UTSW 6 78371814 missense probably damaging 0.98
R2513:Reg3b UTSW 6 78371819 missense probably benign 0.00
R3877:Reg3b UTSW 6 78371233 missense possibly damaging 0.65
R4033:Reg3b UTSW 6 78373209 missense possibly damaging 0.71
R4874:Reg3b UTSW 6 78372826 missense possibly damaging 0.53
R5118:Reg3b UTSW 6 78372128 missense probably damaging 1.00
R5301:Reg3b UTSW 6 78371260 missense probably damaging 0.96
R5344:Reg3b UTSW 6 78372860 missense probably benign 0.02
R5408:Reg3b UTSW 6 78373232 missense probably benign
R5824:Reg3b UTSW 6 78372121 missense possibly damaging 0.83
R6643:Reg3b UTSW 6 78372922 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CTCACTAGGGTGCAGAACCCAATG -3'
(R):5'- GCAGACATAGGGCAACTTCACCTC -3'

Sequencing Primer
(F):5'- TGCAGAACCCAATGGAGGTG -3'
(R):5'- TGAGCACTCAGAATCTTGGGTAAC -3'
Posted On2014-02-18