Incidental Mutation 'R1322:Hipk1'
ID157704
Institutional Source Beutler Lab
Gene Symbol Hipk1
Ensembl Gene ENSMUSG00000008730
Gene Namehomeodomain interacting protein kinase 1
Synonyms1110062K04Rik, Myak
MMRRC Submission 039388-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1322 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103739815-103791563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103743981 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1155 (S1155R)
Ref Sequence ENSEMBL: ENSMUSP00000102458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029438] [ENSMUST00000106845] [ENSMUST00000106852] [ENSMUST00000118317] [ENSMUST00000137078]
Predicted Effect probably damaging
Transcript: ENSMUST00000029438
AA Change: S1200R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029438
Gene: ENSMUSG00000008730
AA Change: S1200R

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106845
AA Change: S1155R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102458
Gene: ENSMUSG00000008730
AA Change: S1155R

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 1002 1018 N/A INTRINSIC
low complexity region 1050 1066 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106852
Predicted Effect probably damaging
Transcript: ENSMUST00000118317
AA Change: S1200R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113998
Gene: ENSMUSG00000008730
AA Change: S1200R

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 941 959 N/A INTRINSIC
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1095 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137078
SMART Domains Protein: ENSMUSP00000120396
Gene: ENSMUSG00000008730

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 151 170 N/A INTRINSIC
S_TKc 190 518 3.39e-76 SMART
low complexity region 586 603 N/A INTRINSIC
low complexity region 672 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200071
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr family of protein kinases and HIPK subfamily. It phosphorylates homeodomain transcription factors and may also function as a co-repressor for homeodomain transcription factors. Alternative splicing results in four transcript variants encoding four distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile, do not develop spontaneous tumors, and are resistant to DMBA-induced skin tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 C T 15: 81,895,193 S33L probably damaging Het
Col27a1 A C 4: 63,328,566 probably benign Het
Fam184a G T 10: 53,652,319 D815E probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gpr162 G T 6: 124,858,901 T512K probably damaging Het
Itih2 A G 2: 10,109,522 V417A probably damaging Het
Kmt2a A G 9: 44,821,121 probably benign Het
Mecom G T 3: 29,957,373 P670Q probably damaging Het
Mgat4d A G 8: 83,365,725 T247A possibly damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr830 T C 9: 18,875,521 F65L possibly damaging Het
Polr1c T C 17: 46,244,163 K327R possibly damaging Het
Prpf39 A T 12: 65,042,662 N58I possibly damaging Het
Sh3bp2 T A 5: 34,555,493 N92K probably damaging Het
Sppl3 TGG TG 5: 115,088,293 probably null Het
Tcrg-C3 T C 13: 19,261,194 F104S probably benign Het
Tnc C T 4: 64,013,994 V728M probably damaging Het
Vmn2r88 T G 14: 51,414,108 I293S probably damaging Het
Zfp251 C T 15: 76,854,236 R219Q possibly damaging Het
Zfp930 A G 8: 69,228,168 T171A probably benign Het
Other mutations in Hipk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Hipk1 APN 3 103778160 missense possibly damaging 0.49
IGL01024:Hipk1 APN 3 103760636 missense probably benign 0.31
IGL01069:Hipk1 APN 3 103777699 missense possibly damaging 0.95
IGL01798:Hipk1 APN 3 103761559 missense probably damaging 0.99
IGL01937:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL01945:Hipk1 APN 3 103744004 missense possibly damaging 0.71
IGL02184:Hipk1 APN 3 103758750 missense possibly damaging 0.96
IGL02430:Hipk1 APN 3 103760655 missense probably damaging 1.00
IGL02603:Hipk1 APN 3 103750272 missense probably damaging 0.97
IGL02632:Hipk1 APN 3 103760545 missense probably benign 0.14
IGL02686:Hipk1 APN 3 103778017 missense possibly damaging 0.82
IGL03293:Hipk1 APN 3 103777259 missense possibly damaging 0.83
effluvient UTSW 3 103754325 splice site probably null
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0012:Hipk1 UTSW 3 103763680 missense probably damaging 0.98
R0512:Hipk1 UTSW 3 103760574 missense possibly damaging 0.95
R0741:Hipk1 UTSW 3 103746812 missense probably benign 0.17
R0785:Hipk1 UTSW 3 103754325 splice site probably null
R0786:Hipk1 UTSW 3 103744304 missense probably benign
R0833:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R0836:Hipk1 UTSW 3 103754296 missense probably damaging 0.98
R1165:Hipk1 UTSW 3 103761524 missense possibly damaging 0.62
R1384:Hipk1 UTSW 3 103758774 splice site probably benign
R1521:Hipk1 UTSW 3 103777782 missense probably benign 0.16
R1543:Hipk1 UTSW 3 103778164 missense probably benign 0.00
R2085:Hipk1 UTSW 3 103750354 missense probably benign 0.00
R2158:Hipk1 UTSW 3 103760538 missense probably damaging 1.00
R2291:Hipk1 UTSW 3 103761610 missense probably damaging 1.00
R3522:Hipk1 UTSW 3 103744114 missense probably damaging 0.96
R4516:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4518:Hipk1 UTSW 3 103750372 missense probably damaging 0.98
R4884:Hipk1 UTSW 3 103744022 missense possibly damaging 0.47
R5023:Hipk1 UTSW 3 103777507 missense probably damaging 1.00
R6045:Hipk1 UTSW 3 103746902 missense probably benign 0.45
R6641:Hipk1 UTSW 3 103753405 missense probably damaging 0.99
R6904:Hipk1 UTSW 3 103777512 missense possibly damaging 0.90
R6925:Hipk1 UTSW 3 103778245 missense unknown
R7169:Hipk1 UTSW 3 103744217 missense probably benign
R7212:Hipk1 UTSW 3 103777610 nonsense probably null
R7313:Hipk1 UTSW 3 103778258 missense unknown
Z1088:Hipk1 UTSW 3 103764544 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGGAAAAGCCTTCTGCTTCAGTG -3'
(R):5'- GCAGTCATCGTCAGCTTCAACCTC -3'

Sequencing Primer
(F):5'- TAATGGAGGTGCTCTCCAGA -3'
(R):5'- ACAGCAGGCATTTGTGGC -3'
Posted On2014-02-18