Incidental Mutation 'R1323:Elovl1'
ID157732
Institutional Source Beutler Lab
Gene Symbol Elovl1
Ensembl Gene ENSMUSG00000006390
Gene Nameelongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1
SynonymsSsc1
MMRRC Submission 039389-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1323 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118428093-118432953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118431654 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 103 (L103P)
Ref Sequence ENSEMBL: ENSMUSP00000099734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006557] [ENSMUST00000006565] [ENSMUST00000067896] [ENSMUST00000102673] [ENSMUST00000167636]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006557
AA Change: L180P

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006557
Gene: ENSMUSG00000006390
AA Change: L180P

DomainStartEndE-ValueType
Pfam:ELO 23 263 3.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006565
SMART Domains Protein: ENSMUSP00000006565
Gene: ENSMUSG00000006398

DomainStartEndE-ValueType
WD40 169 210 7.36e1 SMART
WD40 215 254 3.64e-2 SMART
WD40 257 294 9.6e-2 SMART
WD40 298 337 1.62e-8 SMART
WD40 344 386 8.29e-6 SMART
WD40 389 429 2.21e1 SMART
WD40 432 471 7.85e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000067896
AA Change: L180P

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064816
Gene: ENSMUSG00000006390
AA Change: L180P

DomainStartEndE-ValueType
Pfam:ELO 23 262 8.5e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102673
AA Change: L103P

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099734
Gene: ENSMUSG00000006390
AA Change: L103P

DomainStartEndE-ValueType
Pfam:ELO 2 186 5.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151302
Predicted Effect possibly damaging
Transcript: ENSMUST00000167636
AA Change: L180P

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126685
Gene: ENSMUSG00000006390
AA Change: L180P

DomainStartEndE-ValueType
Pfam:ELO 23 263 3.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183942
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 96.6%
  • 10x: 89.2%
  • 20x: 70.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hoozygous for a targeted allele exhibit complete neonatal lethality, abnormal skin morphology, impaired skin barrier function, decreased weight and impaired formation of very long chain fatty acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C A 11: 9,290,937 F933L possibly damaging Het
Abcc8 T G 7: 46,117,362 Q998P probably benign Het
Akr1e1 C T 13: 4,607,548 G17E probably damaging Het
D630045J12Rik T C 6: 38,148,508 I1524V probably damaging Het
Fam171a2 T G 11: 102,444,125 D62A probably damaging Het
Frzb G A 2: 80,413,376 P320S probably benign Het
Fsip2 G T 2: 82,985,752 G3943V probably damaging Het
Gm813 G A 16: 58,616,915 P10L possibly damaging Het
Grm8 A G 6: 28,125,974 L51P probably damaging Het
Hist1h2al T G 13: 51,203,064 noncoding transcript Het
Hnf4g T C 3: 3,634,221 S4P possibly damaging Het
Megf8 T A 7: 25,360,102 probably null Het
Mtnr1b A G 9: 15,863,136 F209S probably damaging Het
Nckipsd G A 9: 108,812,579 R313Q probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Paqr5 C T 9: 61,961,528 probably null Het
S100a14 T C 3: 90,527,736 V18A probably damaging Het
Sycp2 A T 2: 178,347,621 S1441R possibly damaging Het
Vmn2r101 G A 17: 19,612,051 D770N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zfp600 A G 4: 146,196,691 Y643C probably damaging Het
Other mutations in Elovl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Elovl1 APN 4 118430910 splice site probably null
IGL01613:Elovl1 APN 4 118431270 missense probably benign 0.06
IGL02598:Elovl1 APN 4 118431419 unclassified probably null
IGL03082:Elovl1 APN 4 118430880 missense probably benign 0.00
R1323:Elovl1 UTSW 4 118431654 missense possibly damaging 0.79
R1521:Elovl1 UTSW 4 118432000 missense probably benign 0.14
R1765:Elovl1 UTSW 4 118430510 start codon destroyed probably null 0.13
R1894:Elovl1 UTSW 4 118430748 missense probably damaging 0.99
R2139:Elovl1 UTSW 4 118431106 missense probably damaging 0.99
R4667:Elovl1 UTSW 4 118430787 missense probably damaging 1.00
R4957:Elovl1 UTSW 4 118431923 missense probably damaging 1.00
R5262:Elovl1 UTSW 4 118430927 unclassified probably benign
R5665:Elovl1 UTSW 4 118431635 missense probably damaging 0.99
R5775:Elovl1 UTSW 4 118430897 missense probably benign 0.27
R6676:Elovl1 UTSW 4 118430503 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGGTCATTGAGCTGATGGACAC -3'
(R):5'- ATTTTGCTGAACTGCACGGGGC -3'

Sequencing Primer
(F):5'- CACAGTGAGTGTTACAGCTACTAC -3'
(R):5'- CCCCTTGGTGTAAGAGTGATAC -3'
Posted On2014-02-18