Incidental Mutation 'R1323:Nrbp1'
ID157733
Institutional Source Beutler Lab
Gene Symbol Nrbp1
Ensembl Gene ENSMUSG00000029148
Gene Namenuclear receptor binding protein 1
SynonymsB230344L17Rik, Nrbp
MMRRC Submission 039389-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1323 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31240864-31251566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31245813 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 210 (I210N)
Ref Sequence ENSEMBL: ENSMUSP00000143872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031034] [ENSMUST00000068997] [ENSMUST00000201259] [ENSMUST00000202505] [ENSMUST00000202576] [ENSMUST00000202842]
Predicted Effect probably damaging
Transcript: ENSMUST00000031034
AA Change: I210N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031034
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 324 5.8e-26 PFAM
Pfam:Pkinase 80 327 1e-26 PFAM
low complexity region 412 436 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068997
SMART Domains Protein: ENSMUSP00000070496
Gene: ENSMUSG00000055424

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
low complexity region 78 101 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078312
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077426
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000139602
AA Change: I194N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141973
AA Change: S309T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201070
Predicted Effect probably benign
Transcript: ENSMUST00000201259
Predicted Effect probably damaging
Transcript: ENSMUST00000202505
AA Change: I125N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144292
Gene: ENSMUSG00000029148
AA Change: I125N

DomainStartEndE-ValueType
STYKc 14 184 1.3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202576
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143872
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202801
Predicted Effect probably benign
Transcript: ENSMUST00000202842
SMART Domains Protein: ENSMUSP00000143899
Gene: ENSMUSG00000029148

DomainStartEndE-ValueType
Pfam:Pkinase 2 88 4.8e-5 PFAM
Pfam:Pkinase_Tyr 3 88 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202982
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 96.6%
  • 10x: 89.2%
  • 20x: 70.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C A 11: 9,290,937 F933L possibly damaging Het
Abcc8 T G 7: 46,117,362 Q998P probably benign Het
Akr1e1 C T 13: 4,607,548 G17E probably damaging Het
D630045J12Rik T C 6: 38,148,508 I1524V probably damaging Het
Elovl1 T C 4: 118,431,654 L103P possibly damaging Het
Fam171a2 T G 11: 102,444,125 D62A probably damaging Het
Frzb G A 2: 80,413,376 P320S probably benign Het
Fsip2 G T 2: 82,985,752 G3943V probably damaging Het
Gm813 G A 16: 58,616,915 P10L possibly damaging Het
Grm8 A G 6: 28,125,974 L51P probably damaging Het
Hist1h2al T G 13: 51,203,064 noncoding transcript Het
Hnf4g T C 3: 3,634,221 S4P possibly damaging Het
Megf8 T A 7: 25,360,102 probably null Het
Mtnr1b A G 9: 15,863,136 F209S probably damaging Het
Nckipsd G A 9: 108,812,579 R313Q probably damaging Het
Paqr5 C T 9: 61,961,528 probably null Het
S100a14 T C 3: 90,527,736 V18A probably damaging Het
Sycp2 A T 2: 178,347,621 S1441R possibly damaging Het
Vmn2r101 G A 17: 19,612,051 D770N probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zfp600 A G 4: 146,196,691 Y643C probably damaging Het
Other mutations in Nrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nrbp1 APN 5 31251059 missense possibly damaging 0.74
IGL00926:Nrbp1 APN 5 31243797 missense probably benign 0.07
ghetto UTSW 5 31245846 critical splice donor site probably null
pudong UTSW 5 31250137 missense probably damaging 1.00
Shanghai UTSW 5 31245813 missense probably damaging 1.00
R0358:Nrbp1 UTSW 5 31244887 missense probably damaging 1.00
R0993:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1139:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1177:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1179:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1180:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1193:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1194:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1196:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1267:Nrbp1 UTSW 5 31250590 missense probably benign 0.00
R1302:Nrbp1 UTSW 5 31249889 missense probably benign 0.00
R1320:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1321:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1322:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1324:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1325:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1341:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1388:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1411:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1448:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1697:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1815:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1816:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1950:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1987:Nrbp1 UTSW 5 31245391 missense probably damaging 1.00
R2079:Nrbp1 UTSW 5 31251073 missense probably benign 0.08
R2142:Nrbp1 UTSW 5 31247929 missense possibly damaging 0.95
R4299:Nrbp1 UTSW 5 31250599 critical splice donor site probably null
R5115:Nrbp1 UTSW 5 31243715 nonsense probably null
R5168:Nrbp1 UTSW 5 31250137 missense probably damaging 1.00
R5640:Nrbp1 UTSW 5 31249585 missense possibly damaging 0.96
R6765:Nrbp1 UTSW 5 31245846 critical splice donor site probably null
R7022:Nrbp1 UTSW 5 31244481 missense probably damaging 1.00
R7044:Nrbp1 UTSW 5 31249946 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAGAGCTGGCCCTTACTCTTCTTAAC -3'
(R):5'- TTTGGCCCGAAGGACTAGAGTCAGAC -3'

Sequencing Primer
(F):5'- ACCCTTGGGTTCCCCCTG -3'
(R):5'- GAAGGACTAGAGTCAGACCTCATATC -3'
Posted On2014-02-18