Incidental Mutation 'R1304:Or9g4'
ID 157747
Institutional Source Beutler Lab
Gene Symbol Or9g4
Ensembl Gene ENSMUSG00000075211
Gene Name olfactory receptor family 9 subfamily G member 4
Synonyms MOR213-4, Olfr1006, GA_x6K02T2Q125-47154544-47153606
MMRRC Submission 039370-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1304 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 85504555-85509085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85504682 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099917] [ENSMUST00000216084]
AlphaFold A2ALD2
Predicted Effect probably benign
Transcript: ENSMUST00000099917
AA Change: D271G

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097501
Gene: ENSMUSG00000075211
AA Change: D271G

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.3e-51 PFAM
Pfam:7tm_1 49 298 3.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099919
AA Change: D271G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097503
Gene: ENSMUSG00000075211
AA Change: D271G

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 3.7e-30 PFAM
Pfam:7tm_4 139 283 3.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216084
AA Change: D271G

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216207
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankmy2 T G 12: 36,236,804 (GRCm39) I204S probably damaging Het
Cdh12 T G 15: 21,584,023 (GRCm39) L621R probably benign Het
Dnah9 A G 11: 65,818,414 (GRCm39) I3308T probably damaging Het
Dync2h1 A G 9: 7,102,318 (GRCm39) L454P probably damaging Het
Ece2 A G 16: 20,430,532 (GRCm39) E53G probably damaging Het
Kcp T A 6: 29,501,291 (GRCm39) probably benign Het
Lyst C A 13: 13,926,569 (GRCm39) Y3458* probably null Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Or12e13 C T 2: 87,664,049 (GRCm39) T222I possibly damaging Het
Pde6a A G 18: 61,391,364 (GRCm39) T570A probably damaging Het
Plekha1 A G 7: 130,503,949 (GRCm39) T219A probably benign Het
Prkdc T A 16: 15,577,587 (GRCm39) F2380L probably damaging Het
Slc35b4 T A 6: 34,140,300 (GRCm39) K151* probably null Het
Tmem241 A G 18: 12,203,135 (GRCm39) probably null Het
Zfp607a C A 7: 27,565,000 (GRCm39) R56S probably benign Het
Other mutations in Or9g4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Or9g4 APN 2 85,504,841 (GRCm39) missense probably damaging 1.00
IGL01520:Or9g4 APN 2 85,504,701 (GRCm39) missense probably benign 0.00
IGL01939:Or9g4 APN 2 85,505,285 (GRCm39) missense probably damaging 1.00
IGL02060:Or9g4 APN 2 85,505,178 (GRCm39) missense probably benign 0.34
IGL02171:Or9g4 APN 2 85,505,285 (GRCm39) missense probably damaging 1.00
IGL03058:Or9g4 APN 2 85,505,025 (GRCm39) missense probably benign 0.00
IGL03210:Or9g4 APN 2 85,504,697 (GRCm39) missense probably damaging 1.00
BB002:Or9g4 UTSW 2 85,504,907 (GRCm39) missense
BB012:Or9g4 UTSW 2 85,504,907 (GRCm39) missense
R0294:Or9g4 UTSW 2 85,505,060 (GRCm39) missense probably damaging 0.99
R1476:Or9g4 UTSW 2 85,505,262 (GRCm39) missense possibly damaging 0.92
R4757:Or9g4 UTSW 2 85,504,664 (GRCm39) missense probably damaging 1.00
R4793:Or9g4 UTSW 2 85,504,842 (GRCm39) missense probably damaging 1.00
R5804:Or9g4 UTSW 2 85,504,682 (GRCm39) missense probably damaging 1.00
R6146:Or9g4 UTSW 2 85,504,938 (GRCm39) nonsense probably null
R6511:Or9g4 UTSW 2 85,505,184 (GRCm39) missense possibly damaging 0.61
R6896:Or9g4 UTSW 2 85,505,277 (GRCm39) missense probably damaging 0.97
R7075:Or9g4 UTSW 2 85,505,168 (GRCm39) missense
R7344:Or9g4 UTSW 2 85,505,275 (GRCm39) nonsense probably null
R7350:Or9g4 UTSW 2 85,505,189 (GRCm39) missense
R7925:Or9g4 UTSW 2 85,504,907 (GRCm39) missense
R8704:Or9g4 UTSW 2 85,504,562 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGCTCATCATTTCACCATTCAAAGGGTC -3'
(R):5'- GCAAACACCTTCCGGCTAACTTTCTG -3'

Sequencing Primer
(F):5'- TCACCATTCAAAGGGTCACTTG -3'
(R):5'- CTATGAAAAAGTCCTCCTGGGTG -3'
Posted On 2014-02-18