Mutagenetix > Incidental Mutation

Incidental Mutation 'R1304:Kcp'

157749

Institutional Source

Beutler Lab

Gene Symbol

Kcp

Ensembl Gene

ENSMUSG00000059022

Gene Name

kielin/chordin-like protein

Synonyms

Crim2, LOC333088, KCP

MMRRC Submission

039370-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R1304 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29473161-29507951 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 29501291 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124097 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000078112] [ENSMUST00000078112] [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000101614] [ENSMUST00000161237]

AlphaFold

Q3U492

Predicted Effect

probably benign
Transcript: ENSMUST00000078112

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000078112

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000078112

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000078112

SMART Domains

Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
Pfam:VWD	1214	1254	4.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000091391

SMART Domains

Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1082	6.53e-9	SMART
VWC	1089	1142	1.05e-3	SMART
VWC	1149	1206	2.93e-11	SMART
Pfam:VWD	1213	1253	4.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000091391

SMART Domains

Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	7e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1082	6.53e-9	SMART
VWC	1089	1142	1.05e-3	SMART
VWC	1149	1206	2.93e-11	SMART
Pfam:VWD	1213	1253	4.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000101614

SMART Domains

Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	8e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
VWD	1201	1362	6.09e-50	SMART
C8	1404	1479	1.55e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000101614

SMART Domains

Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
SCOP:d1fxkc_	64	91	8e-3	SMART
VWC	136	190	1.41e-13	SMART
VWC	194	250	1.24e-9	SMART
VWC	255	311	4.55e-8	SMART
VWC	314	369	8.88e-11	SMART
VWC	428	484	9.15e-13	SMART
VWC	487	543	7.61e-10	SMART
VWC	546	601	4.05e-5	SMART
VWC	604	660	8.28e-11	SMART
VWC	667	723	6.58e-5	SMART
VWC	726	780	2.14e-4	SMART
VWC	783	839	1.98e-8	SMART
VWC	842	898	1.35e-1	SMART
VWC	901	957	5.77e-10	SMART
VWC	960	1015	1.21e-3	SMART
VWC	1018	1083	2.44e-8	SMART
VWC	1090	1143	1.05e-3	SMART
VWC	1150	1207	2.93e-11	SMART
VWD	1201	1362	6.09e-50	SMART
C8	1404	1479	1.55e-34	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000160181
AA Change: S81C

SMART Domains

Protein: ENSMUSP00000125699
Gene: ENSMUSG00000059022
AA Change: S81C

Domain	Start	End	E-Value	Type
VWC	18	74	1.24e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161237

SMART Domains

Protein: ENSMUSP00000124097
Gene: ENSMUSG00000059022

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
coiled coil region	60	92	N/A	INTRINSIC
internal_repeat_1	94	117	8.56e-6	PROSPERO
internal_repeat_1	136	159	8.56e-6	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162959

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.4%
20x: 90.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankmy2	T	G	12: 36,236,804 (GRCm39)	I204S	probably damaging	Het
Cdh12	T	G	15: 21,584,023 (GRCm39)	L621R	probably benign	Het
Dnah9	A	G	11: 65,818,414 (GRCm39)	I3308T	probably damaging	Het
Dync2h1	A	G	9: 7,102,318 (GRCm39)	L454P	probably damaging	Het
Ece2	A	G	16: 20,430,532 (GRCm39)	E53G	probably damaging	Het
Lyst	C	A	13: 13,926,569 (GRCm39)	Y3458*	probably null	Het
Ntn4	C	T	10: 93,543,215 (GRCm39)	R314W	probably damaging	Het
Or12e13	C	T	2: 87,664,049 (GRCm39)	T222I	possibly damaging	Het
Or9g4	T	C	2: 85,504,682 (GRCm39)	D271G	probably damaging	Het
Pde6a	A	G	18: 61,391,364 (GRCm39)	T570A	probably damaging	Het
Plekha1	A	G	7: 130,503,949 (GRCm39)	T219A	probably benign	Het
Prkdc	T	A	16: 15,577,587 (GRCm39)	F2380L	probably damaging	Het
Slc35b4	T	A	6: 34,140,300 (GRCm39)	K151*	probably null	Het
Tmem241	A	G	18: 12,203,135 (GRCm39)		probably null	Het
Zfp607a	C	A	7: 27,565,000 (GRCm39)	R56S	probably benign	Het

Other mutations in Kcp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Kcp	APN	6	29,482,656 (GRCm39)	missense	probably benign
IGL01344:Kcp	APN	6	29,498,950 (GRCm39)	splice site	probably null
IGL01404:Kcp	APN	6	29,496,638 (GRCm39)	missense	probably damaging	0.99
IGL01735:Kcp	APN	6	29,498,878 (GRCm39)	missense	probably damaging	1.00
IGL01776:Kcp	APN	6	29,497,907 (GRCm39)	missense	probably damaging	1.00
IGL02092:Kcp	APN	6	29,489,031 (GRCm39)	critical splice donor site	probably null
IGL02252:Kcp	APN	6	29,504,548 (GRCm39)	missense	probably damaging	1.00
IGL02690:Kcp	APN	6	29,484,998 (GRCm39)	unclassified	probably benign
IGL02817:Kcp	APN	6	29,496,968 (GRCm39)	missense	probably damaging	0.97
IGL03074:Kcp	APN	6	29,496,630 (GRCm39)	missense	probably damaging	1.00
P0045:Kcp	UTSW	6	29,498,347 (GRCm39)	missense	probably damaging	1.00
R0219:Kcp	UTSW	6	29,495,784 (GRCm39)	missense	probably damaging	1.00
R0355:Kcp	UTSW	6	29,496,926 (GRCm39)	missense	possibly damaging	0.89
R0738:Kcp	UTSW	6	29,490,438 (GRCm39)	missense	probably benign	0.24
R1111:Kcp	UTSW	6	29,485,422 (GRCm39)	missense	probably benign
R1663:Kcp	UTSW	6	29,498,964 (GRCm39)	missense	possibly damaging	0.68
R1808:Kcp	UTSW	6	29,505,654 (GRCm39)	missense	probably benign	0.05
R1907:Kcp	UTSW	6	29,497,834 (GRCm39)	unclassified	probably benign
R2030:Kcp	UTSW	6	29,489,071 (GRCm39)	missense	probably damaging	1.00
R2099:Kcp	UTSW	6	29,496,164 (GRCm39)	nonsense	probably null
R3411:Kcp	UTSW	6	29,482,845 (GRCm39)	missense	possibly damaging	0.68
R3982:Kcp	UTSW	6	29,484,636 (GRCm39)	missense	probably damaging	1.00
R3983:Kcp	UTSW	6	29,484,636 (GRCm39)	missense	probably damaging	1.00
R4223:Kcp	UTSW	6	29,482,257 (GRCm39)	missense	possibly damaging	0.55
R4377:Kcp	UTSW	6	29,493,202 (GRCm39)	missense	probably damaging	1.00
R4570:Kcp	UTSW	6	29,491,847 (GRCm39)	nonsense	probably null
R4624:Kcp	UTSW	6	29,482,813 (GRCm39)	missense	possibly damaging	0.94
R4694:Kcp	UTSW	6	29,493,196 (GRCm39)	missense	probably benign	0.29
R4750:Kcp	UTSW	6	29,484,625 (GRCm39)	missense	probably benign	0.03
R4968:Kcp	UTSW	6	29,497,628 (GRCm39)	nonsense	probably null
R5053:Kcp	UTSW	6	29,496,957 (GRCm39)	missense	probably benign	0.01
R5067:Kcp	UTSW	6	29,492,107 (GRCm39)	missense	probably benign	0.06
R5253:Kcp	UTSW	6	29,498,519 (GRCm39)	unclassified	probably benign
R5418:Kcp	UTSW	6	29,504,283 (GRCm39)	nonsense	probably null
R6020:Kcp	UTSW	6	29,502,863 (GRCm39)	missense	probably benign	0.03
R6033:Kcp	UTSW	6	29,493,193 (GRCm39)	missense	probably damaging	1.00
R6033:Kcp	UTSW	6	29,493,193 (GRCm39)	missense	probably damaging	1.00
R6088:Kcp	UTSW	6	29,502,631 (GRCm39)	missense	probably benign
R6178:Kcp	UTSW	6	29,482,887 (GRCm39)	missense	possibly damaging	0.68
R6285:Kcp	UTSW	6	29,502,364 (GRCm39)	missense	probably benign	0.21
R6310:Kcp	UTSW	6	29,493,257 (GRCm39)	missense	probably damaging	0.98
R6369:Kcp	UTSW	6	29,484,693 (GRCm39)	missense	probably damaging	1.00
R6860:Kcp	UTSW	6	29,505,719 (GRCm39)	missense	probably benign	0.19
R6949:Kcp	UTSW	6	29,484,611 (GRCm39)	splice site	probably null
R6962:Kcp	UTSW	6	29,482,839 (GRCm39)	missense	probably benign	0.08
R7006:Kcp	UTSW	6	29,499,169 (GRCm39)	missense	probably damaging	1.00
R7138:Kcp	UTSW	6	29,491,861 (GRCm39)	nonsense	probably null
R7141:Kcp	UTSW	6	29,487,511 (GRCm39)	nonsense	probably null
R7153:Kcp	UTSW	6	29,499,014 (GRCm39)	missense	probably damaging	1.00
R7162:Kcp	UTSW	6	29,497,199 (GRCm39)	splice site	probably null
R7334:Kcp	UTSW	6	29,485,511 (GRCm39)	missense	probably damaging	1.00
R7565:Kcp	UTSW	6	29,499,186 (GRCm39)	missense	probably damaging	1.00
R7671:Kcp	UTSW	6	29,496,516 (GRCm39)	missense	probably benign	0.02
R7766:Kcp	UTSW	6	29,496,846 (GRCm39)	missense	probably damaging	0.98
R7781:Kcp	UTSW	6	29,497,764 (GRCm39)	missense	probably damaging	1.00
R8702:Kcp	UTSW	6	29,482,750 (GRCm39)	missense	probably damaging	1.00
R9384:Kcp	UTSW	6	29,496,618 (GRCm39)	critical splice donor site	probably null
R9425:Kcp	UTSW	6	29,489,151 (GRCm39)	missense	probably benign
R9553:Kcp	UTSW	6	29,485,100 (GRCm39)	missense	probably null	1.00
R9752:Kcp	UTSW	6	29,497,754 (GRCm39)	missense	probably damaging	1.00
R9755:Kcp	UTSW	6	29,492,460 (GRCm39)	missense	probably damaging	1.00
Z1176:Kcp	UTSW	6	29,485,011 (GRCm39)	missense	probably benign	0.23
Z1177:Kcp	UTSW	6	29,485,524 (GRCm39)	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- CTCTGTGAGCCAAGATTACCAGCC -3'
(R):5'- AGCAGGGACCAGGTACTGTTGAAC -3'

Sequencing Primer
(F):5'- TTACCAGCCTGCTGAACAGAG -3'
(R):5'- AGGGCTTAGACTCAGCTCTG -3'

Posted On

2014-02-18