Incidental Mutation 'R1304:Tmem241'
ID157763
Institutional Source Beutler Lab
Gene Symbol Tmem241
Ensembl Gene ENSMUSG00000049411
Gene Nametransmembrane protein 241
Synonyms6030446N20Rik
MMRRC Submission 039370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1304 (G1)
Quality Score193
Status Not validated
Chromosome18
Chromosomal Location11964450-12121537 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 12070078 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050228] [ENSMUST00000055447] [ENSMUST00000092075] [ENSMUST00000209628] [ENSMUST00000209859] [ENSMUST00000211298]
Predicted Effect probably benign
Transcript: ENSMUST00000050228
SMART Domains Protein: ENSMUSP00000062148
Gene: ENSMUSG00000049411

DomainStartEndE-ValueType
transmembrane domain 119 136 N/A INTRINSIC
transmembrane domain 200 217 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000055447
SMART Domains Protein: ENSMUSP00000052001
Gene: ENSMUSG00000049411

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
transmembrane domain 121 140 N/A INTRINSIC
transmembrane domain 150 167 N/A INTRINSIC
transmembrane domain 184 201 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092075
SMART Domains Protein: ENSMUSP00000089709
Gene: ENSMUSG00000049411

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
transmembrane domain 121 140 N/A INTRINSIC
transmembrane domain 150 167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209628
Predicted Effect probably null
Transcript: ENSMUST00000209859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210051
Predicted Effect probably benign
Transcript: ENSMUST00000211298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211480
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankmy2 T G 12: 36,186,805 I204S probably damaging Het
Cdh12 T G 15: 21,583,937 L621R probably benign Het
Dnah9 A G 11: 65,927,588 I3308T probably damaging Het
Dync2h1 A G 9: 7,102,318 L454P probably damaging Het
Ece2 A G 16: 20,611,782 E53G probably damaging Het
Kcp T A 6: 29,501,292 probably benign Het
Lyst C A 13: 13,751,984 Y3458* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1006 T C 2: 85,674,338 D271G probably damaging Het
Olfr1148 C T 2: 87,833,705 T222I possibly damaging Het
Pde6a A G 18: 61,258,293 T570A probably damaging Het
Plekha1 A G 7: 130,902,219 T219A probably benign Het
Prkdc T A 16: 15,759,723 F2380L probably damaging Het
Slc35b4 T A 6: 34,163,365 K151* probably null Het
Zfp607a C A 7: 27,865,575 R56S probably benign Het
Other mutations in Tmem241
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02256:Tmem241 APN 18 12113432 missense probably damaging 1.00
R0106:Tmem241 UTSW 18 12106009 intron probably benign
R1203:Tmem241 UTSW 18 12083978 splice site probably benign
R1218:Tmem241 UTSW 18 12064214 missense probably damaging 1.00
R1416:Tmem241 UTSW 18 11993574 missense probably benign 0.00
R1430:Tmem241 UTSW 18 11993594 missense probably benign 0.01
R1539:Tmem241 UTSW 18 12043240 missense possibly damaging 0.92
R1729:Tmem241 UTSW 18 12068312 missense probably damaging 0.99
R1775:Tmem241 UTSW 18 12118412 missense probably damaging 1.00
R3813:Tmem241 UTSW 18 12067110 splice site probably benign
R4352:Tmem241 UTSW 18 12113439 missense probably benign 0.35
R4903:Tmem241 UTSW 18 12104119 missense probably damaging 1.00
R4966:Tmem241 UTSW 18 12104119 missense probably damaging 1.00
R5490:Tmem241 UTSW 18 12043263 missense probably benign 0.00
R5704:Tmem241 UTSW 18 12064206 missense probably damaging 1.00
R6943:Tmem241 UTSW 18 12047584 missense possibly damaging 0.92
R7037:Tmem241 UTSW 18 12113406 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGGGATCAAAGGTTCCTGAGGC -3'
(R):5'- TGTCAGCAGAGCATACAACTGTGAG -3'

Sequencing Primer
(F):5'- CGCTTATACAAGGTGGACCG -3'
(R):5'- GGCTCTCAGAGATGCTCAG -3'
Posted On2014-02-18