Incidental Mutation 'R1305:Nwd2'
ID157771
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
MMRRC Submission 039371-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R1305 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63745197 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 86 (W86L)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584] [ENSMUST00000162166]
Predicted Effect probably damaging
Transcript: ENSMUST00000159584
AA Change: W86L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: W86L

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160066
Predicted Effect probably benign
Transcript: ENSMUST00000162166
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2 G A 5: 121,749,184 V306I probably damaging Het
Enc1 T C 13: 97,246,700 Y573H possibly damaging Het
Gm13757 A T 2: 88,446,302 L212* probably null Het
Gm9869 T C 9: 60,821,886 probably benign Het
Ifna2 T C 4: 88,683,377 T135A probably benign Het
Ifngr1 C T 10: 19,606,253 T197M possibly damaging Het
Kcnj4 A T 15: 79,484,819 V320E probably damaging Het
Map2 T A 1: 66,425,395 I1648N probably damaging Het
Map4k1 A T 7: 28,995,465 M435L probably benign Het
Mark3 T A 12: 111,615,446 probably null Het
Mex3c T A 18: 73,590,235 F466L probably benign Het
Msl3l2 T C 10: 56,115,535 C119R probably damaging Het
Msln T C 17: 25,753,027 E72G probably benign Het
Nid2 T C 14: 19,768,862 S475P probably benign Het
Nme8 T A 13: 19,696,907 N18I possibly damaging Het
Olfr1353 T C 10: 78,970,099 I150T probably benign Het
Pard3 T A 8: 127,306,410 S162T possibly damaging Het
Ppm1a C A 12: 72,783,720 D6E probably damaging Het
Rcor3 C T 1: 192,116,346 V312I possibly damaging Het
Rgs20 T A 1: 5,021,039 probably null Het
Slc11a2 C A 15: 100,410,082 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Vmn1r124 C A 7: 21,260,263 V119F probably benign Het
Zfp827 A G 8: 79,060,894 T230A possibly damaging Het
Zfp945 T C 17: 22,852,386 K180E probably damaging Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63808271 missense probably benign
R1800:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2258:Nwd2 UTSW 5 63805156 missense probably benign 0.00
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63806571 missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63804460 missense probably benign 0.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5761:Nwd2 UTSW 5 63725230 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63805788 missense probably benign 0.00
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63804451 missense probably benign 0.00
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACCCCTCTACCAAGGGAGTG -3'
(R):5'- GCTGGATAACTGGTCAACTCCAGTC -3'

Sequencing Primer
(F):5'- TCCCTGCAGGGGAATTAATG -3'
(R):5'- accaaccaaccaaccaacc -3'
Posted On2014-02-18