Incidental Mutation 'R1305:Mark3'
ID157783
Institutional Source Beutler Lab
Gene Symbol Mark3
Ensembl Gene ENSMUSG00000007411
Gene NameMAP/microtubule affinity regulating kinase 3
SynonymsA430080F22Rik, ETK-1, C-TAK1, 1600015G02Rik
MMRRC Submission 039371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R1305 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111574523-111656221 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 111615446 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075281] [ENSMUST00000084953] [ENSMUST00000221448] [ENSMUST00000221459] [ENSMUST00000221753] [ENSMUST00000222870]
Predicted Effect probably null
Transcript: ENSMUST00000075281
SMART Domains Protein: ENSMUSP00000074757
Gene: ENSMUSG00000007411

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 683 729 3.7e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084953
SMART Domains Protein: ENSMUSP00000082017
Gene: ENSMUSG00000007411

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 700 744 4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221390
Predicted Effect probably benign
Transcript: ENSMUST00000221448
Predicted Effect probably null
Transcript: ENSMUST00000221459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221631
Predicted Effect probably null
Transcript: ENSMUST00000221753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222080
Predicted Effect probably benign
Transcript: ENSMUST00000222870
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous disruption of this gene results in decreased body weight, increased energy expenditure, reduced adiposity, and protection from high-fat diet induced obesity. On a high-fat diet, mice show resistance to hepatic steatosis, improved glucose tolerance, and decreased insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2 G A 5: 121,749,184 V306I probably damaging Het
Enc1 T C 13: 97,246,700 Y573H possibly damaging Het
Gm13757 A T 2: 88,446,302 L212* probably null Het
Gm9869 T C 9: 60,821,886 probably benign Het
Ifna2 T C 4: 88,683,377 T135A probably benign Het
Ifngr1 C T 10: 19,606,253 T197M possibly damaging Het
Kcnj4 A T 15: 79,484,819 V320E probably damaging Het
Map2 T A 1: 66,425,395 I1648N probably damaging Het
Map4k1 A T 7: 28,995,465 M435L probably benign Het
Mex3c T A 18: 73,590,235 F466L probably benign Het
Msl3l2 T C 10: 56,115,535 C119R probably damaging Het
Msln T C 17: 25,753,027 E72G probably benign Het
Nid2 T C 14: 19,768,862 S475P probably benign Het
Nme8 T A 13: 19,696,907 N18I possibly damaging Het
Nwd2 G T 5: 63,745,197 W86L probably damaging Het
Olfr1353 T C 10: 78,970,099 I150T probably benign Het
Pard3 T A 8: 127,306,410 S162T possibly damaging Het
Ppm1a C A 12: 72,783,720 D6E probably damaging Het
Rcor3 C T 1: 192,116,346 V312I possibly damaging Het
Rgs20 T A 1: 5,021,039 probably null Het
Slc11a2 C A 15: 100,410,082 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Vmn1r124 C A 7: 21,260,263 V119F probably benign Het
Zfp827 A G 8: 79,060,894 T230A possibly damaging Het
Zfp945 T C 17: 22,852,386 K180E probably damaging Het
Other mutations in Mark3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Mark3 APN 12 111627522 missense probably damaging 0.99
IGL02047:Mark3 APN 12 111618363 missense probably damaging 1.00
IGL02345:Mark3 APN 12 111627107 missense probably damaging 0.99
IGL02637:Mark3 APN 12 111592656 missense probably damaging 0.98
IGL03310:Mark3 APN 12 111647670 missense probably benign
IGL03349:Mark3 APN 12 111628250 missense probably benign 0.19
R0377:Mark3 UTSW 12 111629029 missense probably damaging 0.96
R0551:Mark3 UTSW 12 111633634 missense probably benign
R0846:Mark3 UTSW 12 111627224 missense possibly damaging 0.85
R1104:Mark3 UTSW 12 111618397 splice site probably benign
R1344:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1418:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1434:Mark3 UTSW 12 111623325 splice site probably benign
R1556:Mark3 UTSW 12 111627841 missense probably damaging 0.98
R1569:Mark3 UTSW 12 111633746 missense probably benign 0.01
R1582:Mark3 UTSW 12 111655310 missense probably benign 0.12
R1936:Mark3 UTSW 12 111618365 missense probably damaging 0.99
R1975:Mark3 UTSW 12 111615441 missense probably damaging 1.00
R2507:Mark3 UTSW 12 111627242 missense probably damaging 1.00
R4394:Mark3 UTSW 12 111604523 missense possibly damaging 0.91
R4912:Mark3 UTSW 12 111592653 missense probably benign 0.42
R4926:Mark3 UTSW 12 111618324 nonsense probably null
R5060:Mark3 UTSW 12 111618326 missense probably damaging 0.98
R5133:Mark3 UTSW 12 111655328 missense probably damaging 1.00
R5813:Mark3 UTSW 12 111655443 missense probably damaging 1.00
R5834:Mark3 UTSW 12 111624487 missense probably damaging 0.99
R5926:Mark3 UTSW 12 111592734 missense probably damaging 1.00
R6523:Mark3 UTSW 12 111627235 missense probably damaging 1.00
R6663:Mark3 UTSW 12 111575083 missense probably benign 0.42
R6719:Mark3 UTSW 12 111615442 missense probably damaging 1.00
R6942:Mark3 UTSW 12 111592654 missense probably null 0.02
R6966:Mark3 UTSW 12 111640024 missense probably damaging 0.96
R6978:Mark3 UTSW 12 111627148 missense probably benign
R7303:Mark3 UTSW 12 111655536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCTCTCAGGACTGTTGCTGTTA -3'
(R):5'- GGGAAAAGGGAAGGAACTTCCTATCACT -3'

Sequencing Primer
(F):5'- AGCATTACTGGAAGCATTTGG -3'
(R):5'- gggacaaggcttctctgtg -3'
Posted On2014-02-18