Incidental Mutation 'R1306:Gjd2'
ID157794
Institutional Source Beutler Lab
Gene Symbol Gjd2
Ensembl Gene ENSMUSG00000068615
Gene Namegap junction protein, delta 2
Synonymsconnexin36, Cx36, Gja9
MMRRC Submission 039372-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R1306 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location114009601-114013619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114011865 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 44 (T44A)
Ref Sequence ENSEMBL: ENSMUSP00000087742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090275]
Predicted Effect probably damaging
Transcript: ENSMUST00000090275
AA Change: T44A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087742
Gene: ENSMUSG00000068615
AA Change: T44A

DomainStartEndE-ValueType
CNX 44 77 1.01e-15 SMART
low complexity region 125 137 N/A INTRINSIC
Connexin_CCC 209 275 4.72e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152254
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the connexin protein family. Connexins are gap junction proteins which are arranged in groups of 6 around a central pore to form a connexon, a component of the gap junction intercellular channel. The channels formed by this protein allow cationic molecule exchange between human beta cells and may function in the regulation of insulin secretion. [provided by RefSeq, Oct 2012]
PHENOTYPE: Nullizygous mutations can cause loss of electrical synapses, impaired synchronous activity of inhibitory networks, altered spike synchrony in OB glomeruli, absent coupling of alpha-ganglion cells in retina, and abnormal cued conditioning, nerve fiber andsingle cell responses, and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 T A 7: 81,093,873 L1146H probably damaging Het
Atad2b A G 12: 4,974,239 I121M probably benign Het
Atg2a A T 19: 6,253,021 T1053S probably benign Het
Bend5 C T 4: 111,459,773 Q127* probably null Het
Ccser1 G A 6: 62,380,106 D843N probably damaging Het
Dennd4b A G 3: 90,271,165 T512A probably benign Het
Dnmbp A T 19: 43,901,779 D516E probably benign Het
Dok3 C A 13: 55,527,448 E86* probably null Het
Fat3 A G 9: 16,376,679 I516T probably damaging Het
Gabbr1 T A 17: 37,055,990 probably null Het
Mcm7 C A 5: 138,167,203 A480S probably damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pdzph1 T C 17: 58,932,432 H967R possibly damaging Het
Pik3c2g A G 6: 139,772,428 N227S probably benign Het
Pkd1 T C 17: 24,573,172 S1278P probably damaging Het
Plch2 T C 4: 155,007,140 E71G probably damaging Het
Pnmal1 A G 7: 16,962,025 R428G probably benign Het
Sertad2 T C 11: 20,648,388 S195P probably benign Het
Slc19a3 A G 1: 83,022,762 L178S probably damaging Het
Smarca2 A G 19: 26,770,988 D139G possibly damaging Het
Tm4sf19 G A 16: 32,407,902 V170M probably damaging Het
Vwa3a C G 7: 120,800,390 S1031R possibly damaging Het
Other mutations in Gjd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Gjd2 APN 2 114011777 missense probably damaging 1.00
IGL01759:Gjd2 APN 2 114011106 missense probably benign 0.00
IGL02307:Gjd2 APN 2 114011913 missense possibly damaging 0.95
IGL02862:Gjd2 APN 2 114013143 utr 5 prime probably benign
IGL03206:Gjd2 APN 2 114011723 missense probably damaging 1.00
R0212:Gjd2 UTSW 2 114011472 missense probably benign 0.00
R1637:Gjd2 UTSW 2 114011308 nonsense probably null
R1719:Gjd2 UTSW 2 114013133 start codon destroyed probably null 1.00
R2051:Gjd2 UTSW 2 114011058 missense probably damaging 1.00
R4809:Gjd2 UTSW 2 114011541 missense probably damaging 1.00
R5596:Gjd2 UTSW 2 114011484 missense possibly damaging 0.93
R6891:Gjd2 UTSW 2 114013094 missense possibly damaging 0.85
X0065:Gjd2 UTSW 2 114011637 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAAGCGGGAGATACCTTCCTGTC -3'
(R):5'- TCCCCTGTTCAAGGACTGGTAAGC -3'

Sequencing Primer
(F):5'- ATAGACTCAGCAGGGTCTCTGTC -3'
(R):5'- GCGCTGAAACAGAAAGGG -3'
Posted On2014-02-18