Incidental Mutation 'R1306:Dennd4b'
ID157795
Institutional Source Beutler Lab
Gene Symbol Dennd4b
Ensembl Gene ENSMUSG00000042404
Gene NameDENN/MADD domain containing 4B
Synonyms
MMRRC Submission 039372-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R1306 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90265185-90280669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90271165 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 512 (T512A)
Ref Sequence ENSEMBL: ENSMUSP00000117354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098914] [ENSMUST00000129564]
Predicted Effect probably benign
Transcript: ENSMUST00000098914
AA Change: T523A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096514
Gene: ENSMUSG00000042404
AA Change: T523A

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
uDENN 183 290 1.15e-29 SMART
DENN 324 508 5.26e-70 SMART
dDENN 573 647 1.75e-25 SMART
low complexity region 672 690 N/A INTRINSIC
low complexity region 740 752 N/A INTRINSIC
coiled coil region 902 928 N/A INTRINSIC
low complexity region 1022 1038 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1131 1148 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1424 1439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129564
AA Change: T512A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117354
Gene: ENSMUSG00000042404
AA Change: T512A

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
uDENN 172 279 1.15e-29 SMART
DENN 313 497 5.26e-70 SMART
dDENN 562 636 1.75e-25 SMART
low complexity region 661 679 N/A INTRINSIC
low complexity region 729 741 N/A INTRINSIC
coiled coil region 891 917 N/A INTRINSIC
low complexity region 1011 1027 N/A INTRINSIC
low complexity region 1075 1085 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1120 1137 N/A INTRINSIC
low complexity region 1327 1339 N/A INTRINSIC
low complexity region 1413 1428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138376
SMART Domains Protein: ENSMUSP00000116003
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
coiled coil region 29 55 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 212 222 N/A INTRINSIC
low complexity region 240 253 N/A INTRINSIC
low complexity region 257 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151648
SMART Domains Protein: ENSMUSP00000121350
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
uDENN 2 57 3.71e-6 SMART
Pfam:DENN 91 157 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156358
SMART Domains Protein: ENSMUSP00000118483
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Blast:uDENN 39 97 9e-6 BLAST
Blast:uDENN 164 207 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183900
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 T A 7: 81,093,873 L1146H probably damaging Het
Atad2b A G 12: 4,974,239 I121M probably benign Het
Atg2a A T 19: 6,253,021 T1053S probably benign Het
Bend5 C T 4: 111,459,773 Q127* probably null Het
Ccser1 G A 6: 62,380,106 D843N probably damaging Het
Dnmbp A T 19: 43,901,779 D516E probably benign Het
Dok3 C A 13: 55,527,448 E86* probably null Het
Fat3 A G 9: 16,376,679 I516T probably damaging Het
Gabbr1 T A 17: 37,055,990 probably null Het
Gjd2 T C 2: 114,011,865 T44A probably damaging Het
Mcm7 C A 5: 138,167,203 A480S probably damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pdzph1 T C 17: 58,932,432 H967R possibly damaging Het
Pik3c2g A G 6: 139,772,428 N227S probably benign Het
Pkd1 T C 17: 24,573,172 S1278P probably damaging Het
Plch2 T C 4: 155,007,140 E71G probably damaging Het
Pnmal1 A G 7: 16,962,025 R428G probably benign Het
Sertad2 T C 11: 20,648,388 S195P probably benign Het
Slc19a3 A G 1: 83,022,762 L178S probably damaging Het
Smarca2 A G 19: 26,770,988 D139G possibly damaging Het
Tm4sf19 G A 16: 32,407,902 V170M probably damaging Het
Vwa3a C G 7: 120,800,390 S1031R possibly damaging Het
Other mutations in Dennd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dennd4b APN 3 90271207 missense possibly damaging 0.83
IGL00834:Dennd4b APN 3 90279686 critical splice donor site probably null
IGL01124:Dennd4b APN 3 90269074 missense possibly damaging 0.61
IGL01792:Dennd4b APN 3 90279845 missense probably damaging 0.96
IGL01895:Dennd4b APN 3 90275567 missense probably benign 0.00
IGL02533:Dennd4b APN 3 90272310 missense probably benign 0.02
IGL02630:Dennd4b APN 3 90272977 missense probably benign 0.00
R0107:Dennd4b UTSW 3 90272736 missense possibly damaging 0.92
R0143:Dennd4b UTSW 3 90272364 missense probably damaging 1.00
R1079:Dennd4b UTSW 3 90271178 missense probably benign
R1525:Dennd4b UTSW 3 90270870 missense probably damaging 0.97
R1756:Dennd4b UTSW 3 90271605 missense probably damaging 1.00
R1959:Dennd4b UTSW 3 90268773 missense probably damaging 1.00
R1976:Dennd4b UTSW 3 90273055 missense probably damaging 1.00
R2184:Dennd4b UTSW 3 90275540 missense probably damaging 1.00
R2296:Dennd4b UTSW 3 90275514 missense probably damaging 1.00
R2406:Dennd4b UTSW 3 90275488 missense probably damaging 1.00
R2408:Dennd4b UTSW 3 90271575 nonsense probably null
R4691:Dennd4b UTSW 3 90272312 missense probably damaging 1.00
R5376:Dennd4b UTSW 3 90278056 missense probably benign 0.00
R5466:Dennd4b UTSW 3 90268500 splice site probably null
R5555:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5556:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5557:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5605:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5617:Dennd4b UTSW 3 90275626 missense probably benign
R5692:Dennd4b UTSW 3 90277783 missense probably damaging 1.00
R5790:Dennd4b UTSW 3 90277450 missense probably damaging 1.00
R5957:Dennd4b UTSW 3 90270965 missense probably damaging 1.00
R6130:Dennd4b UTSW 3 90276259 missense probably damaging 1.00
R6183:Dennd4b UTSW 3 90275568 utr 3 prime probably benign
R6505:Dennd4b UTSW 3 90267611 missense probably damaging 1.00
R6631:Dennd4b UTSW 3 90277732 splice site probably null
R6801:Dennd4b UTSW 3 90268779 missense probably damaging 0.98
X0024:Dennd4b UTSW 3 90270971 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CAGATGATCTTCCCTCTGCATTGGC -3'
(R):5'- GCTCAGAAATGCTGCTTCCCCTAC -3'

Sequencing Primer
(F):5'- GTTGATCTTGATACCAACACGC -3'
(R):5'- AGCTTCATTTTATTCCCAACTCAG -3'
Posted On2014-02-18