Incidental Mutation 'R1306:Mcm7'
ID157798
Institutional Source Beutler Lab
Gene Symbol Mcm7
Ensembl Gene ENSMUSG00000029730
Gene Nameminichromosome maintenance complex component 7
SynonymsMcmd7, mCDC47
MMRRC Submission 039372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1306 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138164583-138172422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 138167203 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 480 (A480S)
Ref Sequence ENSEMBL: ENSMUSP00000000505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019638] [ENSMUST00000019662] [ENSMUST00000110951] [ENSMUST00000132639] [ENSMUST00000139983] [ENSMUST00000143241] [ENSMUST00000147920] [ENSMUST00000148094] [ENSMUST00000148879] [ENSMUST00000151318] [ENSMUST00000153867] [ENSMUST00000155902]
Predicted Effect probably damaging
Transcript: ENSMUST00000000505
AA Change: A480S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730
AA Change: A480S

DomainStartEndE-ValueType
Blast:MCM 48 132 1e-41 BLAST
MCM 145 642 N/A SMART
AAA 373 526 2.9e-4 SMART
Blast:MCM 658 719 1e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000019638
SMART Domains Protein: ENSMUSP00000019638
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
JAB_MPN 37 170 9.73e-35 SMART
Pfam:MitMem_reg 191 304 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019662
SMART Domains Protein: ENSMUSP00000019662
Gene: ENSMUSG00000019518

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 142 2e-49 SMART
Pfam:Adap_comp_sub 173 449 2.5e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083593
Predicted Effect probably benign
Transcript: ENSMUST00000110951
SMART Domains Protein: ENSMUSP00000106576
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
JAB_MPN 10 143 9.73e-35 SMART
Pfam:MitMem_reg 163 279 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127881
Predicted Effect probably benign
Transcript: ENSMUST00000132639
SMART Domains Protein: ENSMUSP00000121554
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
Pfam:MitMem_reg 17 112 3.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139223
Predicted Effect probably benign
Transcript: ENSMUST00000139983
SMART Domains Protein: ENSMUSP00000121446
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142254
Predicted Effect probably benign
Transcript: ENSMUST00000143241
SMART Domains Protein: ENSMUSP00000123770
Gene: ENSMUSG00000019518

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 86 2e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147920
Predicted Effect probably benign
Transcript: ENSMUST00000148094
SMART Domains Protein: ENSMUSP00000121344
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 1 25 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148879
SMART Domains Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 6e-44 BLAST
MCM 145 389 1.77e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151318
SMART Domains Protein: ENSMUSP00000121338
Gene: ENSMUSG00000019518

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 47 153 3.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153867
SMART Domains Protein: ENSMUSP00000121566
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 9.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154867
Predicted Effect probably benign
Transcript: ENSMUST00000155902
SMART Domains Protein: ENSMUSP00000120243
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Pfam:MCM_N 1 58 5.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157031
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 6 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. Cyclin D1-dependent kinase, CDK4, is found to associate with this protein, and may regulate the binding of this protein with the tumorsuppressor protein RB1/RB. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 T A 7: 81,093,873 L1146H probably damaging Het
Atad2b A G 12: 4,974,239 I121M probably benign Het
Atg2a A T 19: 6,253,021 T1053S probably benign Het
Bend5 C T 4: 111,459,773 Q127* probably null Het
Ccser1 G A 6: 62,380,106 D843N probably damaging Het
Dennd4b A G 3: 90,271,165 T512A probably benign Het
Dnmbp A T 19: 43,901,779 D516E probably benign Het
Dok3 C A 13: 55,527,448 E86* probably null Het
Fat3 A G 9: 16,376,679 I516T probably damaging Het
Gabbr1 T A 17: 37,055,990 probably null Het
Gjd2 T C 2: 114,011,865 T44A probably damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pdzph1 T C 17: 58,932,432 H967R possibly damaging Het
Pik3c2g A G 6: 139,772,428 N227S probably benign Het
Pkd1 T C 17: 24,573,172 S1278P probably damaging Het
Plch2 T C 4: 155,007,140 E71G probably damaging Het
Pnmal1 A G 7: 16,962,025 R428G probably benign Het
Sertad2 T C 11: 20,648,388 S195P probably benign Het
Slc19a3 A G 1: 83,022,762 L178S probably damaging Het
Smarca2 A G 19: 26,770,988 D139G possibly damaging Het
Tm4sf19 G A 16: 32,407,902 V170M probably damaging Het
Vwa3a C G 7: 120,800,390 S1031R possibly damaging Het
Other mutations in Mcm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Mcm7 APN 5 138169436 missense probably damaging 1.00
IGL01954:Mcm7 APN 5 138167245 missense probably damaging 1.00
IGL02611:Mcm7 APN 5 138167439 missense probably damaging 1.00
ANU23:Mcm7 UTSW 5 138170391 missense probably benign 0.02
PIT1430001:Mcm7 UTSW 5 138167446 unclassified probably benign
R0022:Mcm7 UTSW 5 138164719 makesense probably null
R1865:Mcm7 UTSW 5 138170375 missense possibly damaging 0.47
R2132:Mcm7 UTSW 5 138169102 missense probably damaging 1.00
R3719:Mcm7 UTSW 5 138166714 nonsense probably null
R3781:Mcm7 UTSW 5 138164736 missense probably damaging 0.99
R3782:Mcm7 UTSW 5 138164736 missense probably damaging 0.99
R4724:Mcm7 UTSW 5 138169125 missense probably damaging 1.00
R4882:Mcm7 UTSW 5 138165911 intron probably null
R5012:Mcm7 UTSW 5 138169347 critical splice donor site probably null
R5517:Mcm7 UTSW 5 138164871 missense possibly damaging 0.92
R5718:Mcm7 UTSW 5 138164819 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTTCATTCACCGGAGGTCATTGTC -3'
(R):5'- TGCAGGTCAGTACACAACAGGC -3'

Sequencing Primer
(F):5'- CCGGAGGTCATTGTCTCTGTC -3'
(R):5'- TCCTCTGGTGTAGGGCTCAC -3'
Posted On2014-02-18