Incidental Mutation 'R1306:Sertad2'
ID157806
Institutional Source Beutler Lab
Gene Symbol Sertad2
Ensembl Gene ENSMUSG00000049800
Gene NameSERTA domain containing 2
SynonymsSei2, Trip-Br2, SEI-2
MMRRC Submission 039372-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R1306 (G1)
Quality Score146
Status Not validated
Chromosome11
Chromosomal Location20543253-20653021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20648388 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 195 (S195P)
Ref Sequence ENSEMBL: ENSMUSP00000105215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093292] [ENSMUST00000109585] [ENSMUST00000109586]
Predicted Effect probably benign
Transcript: ENSMUST00000093292
AA Change: S195P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090981
Gene: ENSMUSG00000049800
AA Change: S195P

DomainStartEndE-ValueType
Pfam:SERTA 40 77 1.6e-20 PFAM
low complexity region 89 99 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109585
AA Change: S195P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105214
Gene: ENSMUSG00000049800
AA Change: S195P

DomainStartEndE-ValueType
Pfam:SERTA 40 77 5.3e-20 PFAM
low complexity region 89 99 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109586
AA Change: S195P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105215
Gene: ENSMUSG00000049800
AA Change: S195P

DomainStartEndE-ValueType
Pfam:SERTA 40 77 5.3e-20 PFAM
low complexity region 89 99 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit enhanced lipolysis, thermogenesis, and oxidative metabolism with resistance to diet induced obesity and steatosis and improved when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 T A 7: 81,093,873 L1146H probably damaging Het
Atad2b A G 12: 4,974,239 I121M probably benign Het
Atg2a A T 19: 6,253,021 T1053S probably benign Het
Bend5 C T 4: 111,459,773 Q127* probably null Het
Ccser1 G A 6: 62,380,106 D843N probably damaging Het
Dennd4b A G 3: 90,271,165 T512A probably benign Het
Dnmbp A T 19: 43,901,779 D516E probably benign Het
Dok3 C A 13: 55,527,448 E86* probably null Het
Fat3 A G 9: 16,376,679 I516T probably damaging Het
Gabbr1 T A 17: 37,055,990 probably null Het
Gjd2 T C 2: 114,011,865 T44A probably damaging Het
Mcm7 C A 5: 138,167,203 A480S probably damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pdzph1 T C 17: 58,932,432 H967R possibly damaging Het
Pik3c2g A G 6: 139,772,428 N227S probably benign Het
Pkd1 T C 17: 24,573,172 S1278P probably damaging Het
Plch2 T C 4: 155,007,140 E71G probably damaging Het
Pnmal1 A G 7: 16,962,025 R428G probably benign Het
Slc19a3 A G 1: 83,022,762 L178S probably damaging Het
Smarca2 A G 19: 26,770,988 D139G possibly damaging Het
Tm4sf19 G A 16: 32,407,902 V170M probably damaging Het
Vwa3a C G 7: 120,800,390 S1031R possibly damaging Het
Other mutations in Sertad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03008:Sertad2 APN 11 20647798 splice site probably benign
wisteria UTSW 11 20648664 frame shift probably null
R1171:Sertad2 UTSW 11 20648091 missense probably benign 0.01
R3834:Sertad2 UTSW 11 20648482 missense probably benign 0.15
R4087:Sertad2 UTSW 11 20648664 frame shift probably null
R4940:Sertad2 UTSW 11 20647899 missense possibly damaging 0.52
R5232:Sertad2 UTSW 11 20648344 missense possibly damaging 0.72
R5621:Sertad2 UTSW 11 20648061 missense possibly damaging 0.61
R5891:Sertad2 UTSW 11 20647884 missense probably benign 0.30
R5956:Sertad2 UTSW 11 20647884 missense probably benign 0.30
R6006:Sertad2 UTSW 11 20647884 missense probably benign 0.30
R6007:Sertad2 UTSW 11 20647884 missense probably benign 0.30
R6048:Sertad2 UTSW 11 20648436 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGTCTTACACCTTACAGCGCCAG -3'
(R):5'- AGCAAACAAGATGTCATCCAGGGTC -3'

Sequencing Primer
(F):5'- CGACAACGATGACACTTTTTGC -3'
(R):5'- ATGTCATCCAGGGTCAAGTC -3'
Posted On2014-02-18