Incidental Mutation 'R1306:Meox2'
ID157808
Institutional Source Beutler Lab
Gene Symbol Meox2
Ensembl Gene ENSMUSG00000036144
Gene Namemesenchyme homeobox 2
SynonymsGax, Mox2, Mox-2
MMRRC Submission 039372-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R1306 (G1)
Quality Score105
Status Not validated
Chromosome12
Chromosomal Location37108540-37179534 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) GCACCACCACCACCACCACCA to GCACCACCACCACCACCA at 37109031 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041183]
Predicted Effect probably benign
Transcript: ENSMUST00000041183
SMART Domains Protein: ENSMUSP00000043587
Gene: ENSMUSG00000036144

DomainStartEndE-ValueType
low complexity region 63 85 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
HOX 186 248 1.56e-28 SMART
low complexity region 289 300 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222665
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of non-clustered, diverged, antennapedia-like homeobox-containing genes. The encoded protein may play a role in the regulation of vertebrate limb myogenesis. Mutations in the related mouse protein may be associated with craniofacial and/or skeletal abnormalities, in addition to neurovascular dysfunction observed in Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Several mutations that inactivate the gene result in mild defects of rib and vertebrae development. Inactivation in conjunction with a null mutation in a related homeobox gene results in more severe defects stemming from impaired somite formation, patterning, and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 T A 7: 81,093,873 L1146H probably damaging Het
Atad2b A G 12: 4,974,239 I121M probably benign Het
Atg2a A T 19: 6,253,021 T1053S probably benign Het
Bend5 C T 4: 111,459,773 Q127* probably null Het
Ccser1 G A 6: 62,380,106 D843N probably damaging Het
Dennd4b A G 3: 90,271,165 T512A probably benign Het
Dnmbp A T 19: 43,901,779 D516E probably benign Het
Dok3 C A 13: 55,527,448 E86* probably null Het
Fat3 A G 9: 16,376,679 I516T probably damaging Het
Gabbr1 T A 17: 37,055,990 probably null Het
Gjd2 T C 2: 114,011,865 T44A probably damaging Het
Mcm7 C A 5: 138,167,203 A480S probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pdzph1 T C 17: 58,932,432 H967R possibly damaging Het
Pik3c2g A G 6: 139,772,428 N227S probably benign Het
Pkd1 T C 17: 24,573,172 S1278P probably damaging Het
Plch2 T C 4: 155,007,140 E71G probably damaging Het
Pnmal1 A G 7: 16,962,025 R428G probably benign Het
Sertad2 T C 11: 20,648,388 S195P probably benign Het
Slc19a3 A G 1: 83,022,762 L178S probably damaging Het
Smarca2 A G 19: 26,770,988 D139G possibly damaging Het
Tm4sf19 G A 16: 32,407,902 V170M probably damaging Het
Vwa3a C G 7: 120,800,390 S1031R possibly damaging Het
Other mutations in Meox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02675:Meox2 APN 12 37178334 missense probably damaging 0.99
IGL02935:Meox2 APN 12 37109105 missense probably damaging 0.99
R1173:Meox2 UTSW 12 37109152 missense possibly damaging 0.95
R1705:Meox2 UTSW 12 37167494 splice site probably benign
R2104:Meox2 UTSW 12 37167477 missense probably damaging 1.00
R5028:Meox2 UTSW 12 37108936 missense probably benign
R6118:Meox2 UTSW 12 37109031 small deletion probably benign
R6414:Meox2 UTSW 12 37108831 start codon destroyed probably benign 0.33
R7016:Meox2 UTSW 12 37109224 missense probably benign 0.07
X0023:Meox2 UTSW 12 37109145 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTGCTTGGAAGCCGAAACTTGC -3'
(R):5'- GCTAGATGAGTTGGAACACAGGACC -3'

Sequencing Primer
(F):5'- ATGGAACACCCCCTCTTTGG -3'
(R):5'- ACAGGACCGGAGGGCTG -3'
Posted On2014-02-18