Incidental Mutation 'R1306:Tm4sf19'
ID157811
Institutional Source Beutler Lab
Gene Symbol Tm4sf19
Ensembl Gene ENSMUSG00000079625
Gene Nametransmembrane 4 L six family member 19
SynonymsEG277203
MMRRC Submission 039372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1306 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32400506-32408227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32407902 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 170 (V170M)
Ref Sequence ENSEMBL: ENSMUSP00000110802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115149]
Predicted Effect probably damaging
Transcript: ENSMUST00000115149
AA Change: V170M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110802
Gene: ENSMUSG00000079625
AA Change: V170M

DomainStartEndE-ValueType
Pfam:L6_membrane 9 204 1.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194813
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 T A 7: 81,093,873 L1146H probably damaging Het
Atad2b A G 12: 4,974,239 I121M probably benign Het
Atg2a A T 19: 6,253,021 T1053S probably benign Het
Bend5 C T 4: 111,459,773 Q127* probably null Het
Ccser1 G A 6: 62,380,106 D843N probably damaging Het
Dennd4b A G 3: 90,271,165 T512A probably benign Het
Dnmbp A T 19: 43,901,779 D516E probably benign Het
Dok3 C A 13: 55,527,448 E86* probably null Het
Fat3 A G 9: 16,376,679 I516T probably damaging Het
Gabbr1 T A 17: 37,055,990 probably null Het
Gjd2 T C 2: 114,011,865 T44A probably damaging Het
Mcm7 C A 5: 138,167,203 A480S probably damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pdzph1 T C 17: 58,932,432 H967R possibly damaging Het
Pik3c2g A G 6: 139,772,428 N227S probably benign Het
Pkd1 T C 17: 24,573,172 S1278P probably damaging Het
Plch2 T C 4: 155,007,140 E71G probably damaging Het
Pnmal1 A G 7: 16,962,025 R428G probably benign Het
Sertad2 T C 11: 20,648,388 S195P probably benign Het
Slc19a3 A G 1: 83,022,762 L178S probably damaging Het
Smarca2 A G 19: 26,770,988 D139G possibly damaging Het
Vwa3a C G 7: 120,800,390 S1031R possibly damaging Het
Other mutations in Tm4sf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Tm4sf19 APN 16 32405954 missense possibly damaging 0.63
IGL02468:Tm4sf19 APN 16 32407715 splice site probably benign
IGL02573:Tm4sf19 APN 16 32407860 missense possibly damaging 0.88
IGL02938:Tm4sf19 APN 16 32405915 missense probably damaging 0.98
R1450:Tm4sf19 UTSW 16 32407963 missense probably damaging 1.00
R1522:Tm4sf19 UTSW 16 32406002 missense possibly damaging 0.61
R1895:Tm4sf19 UTSW 16 32407682 missense probably damaging 1.00
R4407:Tm4sf19 UTSW 16 32407894 missense possibly damaging 0.77
R5527:Tm4sf19 UTSW 16 32407921 missense probably damaging 1.00
R6166:Tm4sf19 UTSW 16 32407863 missense probably damaging 1.00
R6949:Tm4sf19 UTSW 16 32405858 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCATAAGCCCAGTCCCGTGATTTG -3'
(R):5'- CAGCATGACTTTGTTGCTGTGAGC -3'

Sequencing Primer
(F):5'- CCGTGATTTGGGCCAGGAG -3'
(R):5'- AAGGGGATTCACAGCCTATTC -3'
Posted On2014-02-18