Incidental Mutation 'R1307:Slc25a28'
ID157844
Institutional Source Beutler Lab
Gene Symbol Slc25a28
Ensembl Gene ENSMUSG00000040414
Gene Namesolute carrier family 25, member 28
Synonyms2210403D18Rik, Mrs3/4, Mfrn2
MMRRC Submission 039373-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R1307 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location43663822-43674881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43667031 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 135 (N135S)
Ref Sequence ENSEMBL: ENSMUSP00000036913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046038]
Predicted Effect probably benign
Transcript: ENSMUST00000046038
AA Change: N135S

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036913
Gene: ENSMUSG00000040414
AA Change: N135S

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
Pfam:Mito_carr 69 162 6.2e-22 PFAM
Pfam:Mito_carr 167 257 1e-19 PFAM
Pfam:Mito_carr 257 357 2.5e-22 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc1 A T 10: 60,012,499 I83L probably benign Het
Bcl2a1b T C 9: 89,199,490 V44A probably damaging Het
Bdp1 T C 13: 100,049,763 D1727G possibly damaging Het
Cabp1 A G 5: 115,172,906 F294L probably damaging Het
Coq8b T A 7: 27,250,591 M365K probably damaging Het
Gk2 A T 5: 97,455,409 D523E probably benign Het
Havcr1 C T 11: 46,756,270 T177I probably damaging Het
Kdm4a T C 4: 118,175,642 T76A probably benign Het
Lama4 A T 10: 39,070,032 I804F probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pcdh10 A G 3: 45,381,879 N876S probably benign Het
Polr3f T C 2: 144,533,193 V95A probably damaging Het
Ptk2 A G 15: 73,292,046 V389A probably benign Het
Rhof T C 5: 123,120,315 E151G probably damaging Het
Sphk1 G A 11: 116,536,102 V295I probably benign Het
Sv2b G T 7: 75,206,434 T36K probably damaging Het
Sybu T C 15: 44,675,390 E291G probably damaging Het
Tnc T C 4: 64,008,859 E810G probably damaging Het
Uba52 T C 8: 70,508,516 H68R probably damaging Het
Unc79 A G 12: 103,070,076 N552S probably damaging Het
Ush2a T C 1: 188,357,967 C416R probably damaging Het
Ush2a T C 1: 188,451,840 V1447A probably damaging Het
Zfp985 C T 4: 147,583,247 L191F probably benign Het
Other mutations in Slc25a28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Slc25a28 APN 19 43664508 missense probably damaging 1.00
IGL02572:Slc25a28 APN 19 43664446 missense probably damaging 1.00
IGL02678:Slc25a28 APN 19 43667147 splice site probably benign
R0732:Slc25a28 UTSW 19 43666953 missense probably benign 0.00
R3950:Slc25a28 UTSW 19 43664269 missense probably benign 0.01
R6057:Slc25a28 UTSW 19 43666925 missense possibly damaging 0.69
R6292:Slc25a28 UTSW 19 43664592 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGGACACTGTGACCTTTGCTGAG -3'
(R):5'- AGATGAGAAGTTACAATCGCCGCC -3'

Sequencing Primer
(F):5'- TCCAAACCATGCGAGGCTG -3'
(R):5'- ACAATCGCCGCCTTTGC -3'
Posted On2014-02-18