Incidental Mutation 'R1310:Hoxa13'
ID157901
Institutional Source Beutler Lab
Gene Symbol Hoxa13
Ensembl Gene ENSMUSG00000038203
Gene Namehomeobox A13
SynonymsHox-1.10
MMRRC Submission 039376-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1310 (G1)
Quality Score131
Status Not validated
Chromosome6
Chromosomal Location52257694-52260880 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CCG to CCGCG at 52260635 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047993] [ENSMUST00000114416] [ENSMUST00000147595]
Predicted Effect probably null
Transcript: ENSMUST00000047993
SMART Domains Protein: ENSMUSP00000039170
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
low complexity region 37 81 N/A INTRINSIC
Pfam:HoxA13_N 136 219 6.2e-25 PFAM
HOX 317 379 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114416
SMART Domains Protein: ENSMUSP00000110059
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 55 1e-19 PFAM
HOX 153 215 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141300
Predicted Effect probably benign
Transcript: ENSMUST00000147595
SMART Domains Protein: ENSMUSP00000125221
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 39 8.3e-11 PFAM
HOX 137 199 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192253
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit agenesis of both the urinary bladder and the caudal portion of the Mullerian ducts, premature stenosis of the umbilical arteries, loss of the most anterior digit of all feet, and death around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,447,936 H678R probably benign Het
Adgrv1 A G 13: 81,566,377 V929A probably benign Het
Bcl10 T G 3: 145,930,425 V26G probably damaging Het
C4b A G 17: 34,729,593 V1581A probably damaging Het
C87436 A G 6: 86,445,450 E2G possibly damaging Het
Def6 G A 17: 28,217,619 V86I probably benign Het
Drd3 A G 16: 43,821,529 K403E probably damaging Het
Eme1 G A 11: 94,645,542 R534C probably damaging Het
H2-T24 G T 17: 36,014,996 Y234* probably null Het
Ifit1bl1 A G 19: 34,593,696 S454P possibly damaging Het
Olfr1265 T A 2: 90,037,703 D261E probably benign Het
Olfr644 C T 7: 104,068,598 M144I probably benign Het
Pde4c A G 8: 70,749,923 D592G possibly damaging Het
Scn11a C T 9: 119,755,057 W1497* probably null Het
Sik3 A G 9: 46,219,426 E1170G possibly damaging Het
Soat1 A G 1: 156,441,332 L183P possibly damaging Het
Svep1 T A 4: 58,069,416 Y2790F possibly damaging Het
Tmeff2 T C 1: 51,181,787 V307A probably damaging Het
Tmem38a T A 8: 72,579,970 F98I probably damaging Het
Yod1 C T 1: 130,718,830 A148V probably benign Het
Zfp850 A C 7: 27,989,459 S441R probably benign Het
Zfp976 G A 7: 42,613,186 P409L probably damaging Het
Other mutations in Hoxa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8786:Hoxa13 UTSW 6 52260636 frame shift probably null
PIT4131001:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
PIT4131001:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R0458:Hoxa13 UTSW 6 52260635 frame shift probably null
R0496:Hoxa13 UTSW 6 52260635 frame shift probably null
R0502:Hoxa13 UTSW 6 52260635 frame shift probably null
R0512:Hoxa13 UTSW 6 52260635 frame shift probably null
R0784:Hoxa13 UTSW 6 52259937 missense probably damaging 0.98
R1062:Hoxa13 UTSW 6 52260635 frame shift probably null
R1157:Hoxa13 UTSW 6 52260635 frame shift probably null
R1192:Hoxa13 UTSW 6 52260635 frame shift probably null
R1341:Hoxa13 UTSW 6 52260635 frame shift probably null
R1343:Hoxa13 UTSW 6 52260635 frame shift probably null
R1398:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1398:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1632:Hoxa13 UTSW 6 52259937 missense probably damaging 0.98
R2382:Hoxa13 UTSW 6 52259145 missense probably damaging 0.98
R3149:Hoxa13 UTSW 6 52260304 intron probably benign
R4012:Hoxa13 UTSW 6 52259127 missense possibly damaging 0.47
R4426:Hoxa13 UTSW 6 52260729 utr 5 prime probably benign
R5535:Hoxa13 UTSW 6 52260540 frame shift probably null
R6175:Hoxa13 UTSW 6 52259928 missense probably damaging 0.98
R7365:Hoxa13 UTSW 6 52259882 missense probably damaging 1.00
X0018:Hoxa13 UTSW 6 52260119 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCGTAGCCCTGATGGTAGAAAGC -3'
(R):5'- TTAAAACAGCGCCACTGGGGTC -3'

Sequencing Primer
(F):5'- TGCCGAAGTAGCCGTAGG -3'
(R):5'- ACTGGGGTCTTCTCCATGC -3'
Posted On2014-02-18