Incidental Mutation 'R1311:Olfr295'
ID157932
Institutional Source Beutler Lab
Gene Symbol Olfr295
Ensembl Gene ENSMUSG00000059319
Gene Nameolfactory receptor 295
SynonymsMOR220-1, GA_x6K02T2NHDJ-9539243-9538314
MMRRC Submission 039377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1311 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86583862-86591128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86585953 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 226 (V226D)
Ref Sequence ENSEMBL: ENSMUSP00000150377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078447] [ENSMUST00000172965] [ENSMUST00000215365]
Predicted Effect probably damaging
Transcript: ENSMUST00000078447
AA Change: V226D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077542
Gene: ENSMUSG00000059319
AA Change: V226D

DomainStartEndE-ValueType
Pfam:7tm_1 39 288 6.1e-26 PFAM
Pfam:7tm_4 137 281 2.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172965
AA Change: V226D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134371
Gene: ENSMUSG00000057067
AA Change: V226D

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.2e-46 PFAM
Pfam:7tm_1 39 288 2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215365
AA Change: V226D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.0352 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.1%
  • 20x: 86.2%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c T C 2: 58,280,249 Q449R probably benign Het
Cap1 A G 4: 122,865,214 Y195H possibly damaging Het
Casp8ap2 T A 4: 32,648,111 N1939K probably damaging Het
Cd209c T A 8: 3,945,908 M1L probably benign Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Col13a1 A G 10: 61,864,010 probably benign Het
Dennd4a T C 9: 64,910,004 V1640A probably benign Het
Eml6 T C 11: 29,831,088 probably benign Het
Fat3 G A 9: 16,021,410 T1409I probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Gm5709 T C 3: 59,618,679 noncoding transcript Het
Htr2b C A 1: 86,110,624 A87S probably damaging Het
Kansl2 G T 15: 98,528,916 H275N possibly damaging Het
Megf6 G A 4: 154,263,782 probably null Het
Mtpn A G 6: 35,512,250 I113T possibly damaging Het
Myh6 G T 14: 54,946,365 A1704E probably damaging Het
Notum C T 11: 120,655,749 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfml1 T C 7: 107,567,896 probably null Het
Ptpn5 A T 7: 47,079,232 probably benign Het
Rapgef2 A G 3: 79,083,547 F985L probably benign Het
Slc7a7 A T 14: 54,373,030 Y386* probably null Het
Snph G T 2: 151,597,202 P36Q probably damaging Het
St18 T C 1: 6,845,644 C838R probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Supt7l T C 5: 31,520,261 Y187C probably damaging Het
Sycp2l A T 13: 41,135,185 K241* probably null Het
Tenm2 G T 11: 36,068,594 probably benign Het
Tfap4 A G 16: 4,559,426 probably null Het
Tmem132e T C 11: 82,444,296 Y643H probably damaging Het
Tmem200c A T 17: 68,840,763 S114C probably damaging Het
Ush2a T C 1: 188,947,145 I4850T possibly damaging Het
Zmym6 G T 4: 127,123,358 L977F probably damaging Het
Other mutations in Olfr295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Olfr295 APN 7 86585439 missense possibly damaging 0.91
IGL02248:Olfr295 APN 7 86586104 nonsense probably null
IGL02309:Olfr295 APN 7 86585497 missense possibly damaging 0.84
IGL02866:Olfr295 APN 7 86585693 nonsense probably null
IGL03059:Olfr295 APN 7 86585571 missense probably benign 0.00
IGL03134:Olfr295 UTSW 7 86586012 missense probably damaging 0.99
R1777:Olfr295 UTSW 7 86586064 missense probably benign
R2259:Olfr295 UTSW 7 86585884 missense possibly damaging 0.80
R2379:Olfr295 UTSW 7 86586192 missense probably benign
R5944:Olfr295 UTSW 7 86585278 start codon destroyed probably null 1.00
R6213:Olfr295 UTSW 7 86585277 start codon destroyed probably null 1.00
R6241:Olfr295 UTSW 7 86586037 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GCCCAATGCTTGTATCAACTCTCTCACT -3'
(R):5'- ACAGCCTTCTTTATCTGTTTGTTTCTAAGACT -3'

Sequencing Primer
(F):5'- ATCACAGGAGCATTTCTTTGGC -3'
(R):5'- CTCAACTATTTCTGAGATTGCTGAAG -3'
Posted On2014-02-18