Incidental Mutation 'R1311:Ckb'
List |< first << previous [record 86 of 585] next >> last >|
ID157943
Institutional Source Beutler Lab
Gene Symbol Ckb
Ensembl Gene ENSMUSG00000001270
Gene Namecreatine kinase, brain
SynonymsB-CK, Ck-3
MMRRC Submission 039377-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1311 (G1)
Quality Score128
Status Validated
Chromosome12
Chromosomal Location111669361-111672338 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TCCACCACCA to TCCACCA at 111669645 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001304]
Predicted Effect probably benign
Transcript: ENSMUST00000001304
SMART Domains Protein: ENSMUSP00000001304
Gene: ENSMUSG00000001270

DomainStartEndE-ValueType
Pfam:ATP-gua_PtransN 24 99 1.9e-36 PFAM
Pfam:ATP-gua_Ptrans 120 367 1.9e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223099
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.1%
  • 20x: 86.2%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in brain as well as in other tissues, and as a heterodimer with a similar muscle isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. A pseudogene of this gene has been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have abnormal hippocampal morphology with enlarged mossy fiber field size and display resistance to pharmacologically induced seizures, reduced habituation and spatial learning impairments. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c T C 2: 58,280,249 Q449R probably benign Het
Cap1 A G 4: 122,865,214 Y195H possibly damaging Het
Casp8ap2 T A 4: 32,648,111 N1939K probably damaging Het
Cd209c T A 8: 3,945,908 M1L probably benign Het
Col13a1 A G 10: 61,864,010 probably benign Het
Dennd4a T C 9: 64,910,004 V1640A probably benign Het
Eml6 T C 11: 29,831,088 probably benign Het
Fat3 G A 9: 16,021,410 T1409I probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Gm5709 T C 3: 59,618,679 noncoding transcript Het
Htr2b C A 1: 86,110,624 A87S probably damaging Het
Kansl2 G T 15: 98,528,916 H275N possibly damaging Het
Megf6 G A 4: 154,263,782 probably null Het
Mtpn A G 6: 35,512,250 I113T possibly damaging Het
Myh6 G T 14: 54,946,365 A1704E probably damaging Het
Notum C T 11: 120,655,749 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfml1 T C 7: 107,567,896 probably null Het
Olfr295 T A 7: 86,585,953 V226D probably damaging Het
Ptpn5 A T 7: 47,079,232 probably benign Het
Rapgef2 A G 3: 79,083,547 F985L probably benign Het
Slc7a7 A T 14: 54,373,030 Y386* probably null Het
Snph G T 2: 151,597,202 P36Q probably damaging Het
St18 T C 1: 6,845,644 C838R probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Supt7l T C 5: 31,520,261 Y187C probably damaging Het
Sycp2l A T 13: 41,135,185 K241* probably null Het
Tenm2 G T 11: 36,068,594 probably benign Het
Tfap4 A G 16: 4,559,426 probably null Het
Tmem132e T C 11: 82,444,296 Y643H probably damaging Het
Tmem200c A T 17: 68,840,763 S114C probably damaging Het
Ush2a T C 1: 188,947,145 I4850T possibly damaging Het
Zmym6 G T 4: 127,123,358 L977F probably damaging Het
Other mutations in Ckb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Ckb APN 12 111669981 missense possibly damaging 0.94
R0179:Ckb UTSW 12 111670176 missense probably benign 0.00
R0686:Ckb UTSW 12 111670193 missense probably benign 0.42
R1065:Ckb UTSW 12 111671247 missense probably benign 0.07
R1481:Ckb UTSW 12 111671262 missense probably benign 0.05
R1888:Ckb UTSW 12 111669645 small deletion probably benign
R1888:Ckb UTSW 12 111669645 small deletion probably benign
R1891:Ckb UTSW 12 111669645 small deletion probably benign
R2345:Ckb UTSW 12 111671804 missense probably damaging 1.00
R4936:Ckb UTSW 12 111671230 missense probably benign 0.14
R5934:Ckb UTSW 12 111670229 missense probably damaging 1.00
R6149:Ckb UTSW 12 111671814 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGTGTCAGCAACAGCTTAGCC -3'
(R):5'- AGAAGGTGCAGGTGTTGTCCTCAG -3'

Sequencing Primer
(F):5'- TCTCTACAGCGAGGCTAAGG -3'
(R):5'- GTGTTGTCCTCAGCCCCG -3'
Posted On2014-02-18